RHCE (NM_138616) Human Untagged Clone
CAT#: SC309556
RHCE (untagged)-Human Rh blood group, CcEe antigens (RHCE), transcript variant 3
CNY 6,270.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CD240CE; RH; Rh4; RH30A; RHC; RHCe(152N); RHE; RhIVb(J); RHIXB; RHNA; RHPI; RhVI; RhVIII |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC309556 representing NM_138616.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAGCTCTAAGTACCCGCGGTCTGTCCGGCGCTGCCTGCCCCTCTGGGCCCTAACACTGGAAGCAGCT CTCATTCTCCTCTTCTATTTTTTTACCCACTATGACGCTTCCTTAGAGGATCAAAAGGGGCTCGTGGCA TCCTATCAAGTCGGCCAAGATCTGACCGTGATGGCGGCCCTTGGCTTGGGCTTCCTCACCTCAAATTTC CGGAGACACAGCTGGAGCAGTGTGGCCTTCAACCTCTTCATGCTGGCGCTTGGTGTGCAGTGGGCAATC CTGCTGGACGGCTTCCTGAGCCAGTTCCCTCCTGGGAAGGTGGTCATCACACTGTTCAGTATTCGGCTG GCCACCATGAGTGCTATGTCGGTGCTGATCTCAGCGGGTGCTGTCTTGGGGAAGGTCAACTTGGCGCAG TTGGTGGTGATGGTGCTGGTGGAGGTGACAGCTTTAGGCACCCTGAGGATGGTCATCAGTAATATCTTC AACGTGTGTTGTAACCGAGTGCTGGGGATTCACCACATCTCCGTCATGCACTCCATCTTCAGCTTGCTG GGTCTGCTTGGAGAGATCACCTACATTGTGCTGCTGGTGCTTCATACTGTCTGGAACGGCAATGGCATG ATTGGCTTCCAGGTCCTCCTCAGCATTGGGGAACTCAGCTTGGCCATCGTGATAGCTCTCACGTCTGGT CTCCTGACAGGTTTGCTCCTAAATCTCAAAATATGGAAAGCACCTCATGTGGCTAAATATTTTGATGAC CAAGTTTTCTGGAAGTTTCCTCATTTGGCTGTTGGATTTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_138616 |
Insert Size | 801 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_138616.3 |
RefSeq Size | 1165 bp |
RefSeq ORF | 801 bp |
Locus ID | 6006 |
UniProt ID | P18577 |
Protein Families | Transmembrane |
MW | 29.3 kDa |
Gene Summary | The Rh blood group system is the second most clinically significant of the blood groups, second only to ABO. It is also the most polymorphic of the blood groups, with variations due to deletions, gene conversions, and missense mutations. The Rh blood group includes this gene which encodes both the RhC and RhE antigens on a single polypeptide and a second gene which encodes the RhD protein. The classification of Rh-positive and Rh-negative individuals is determined by the presence or absence of the highly immunogenic RhD protein on the surface of erythrocytes. A mutation in this gene results in amorph-type Rh-null disease. Alternative splicing of this gene results in multiple transcript variants encoding several different isoforms. [provided by RefSeq, Aug 2016] Transcript Variant: This variant (3), also called RhVIII, lacks three internal exons but maintains the reading frame, as compared to variant 1. Isoform 3 lacks 151 internal aa as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222563 | RHCE (Myc-DDK-tagged)-Human Rh blood group, CcEe antigens (RHCE), transcript variant 3 |
CNY 2,400.00 |
|
RC222563L3 | Lenti ORF clone of Human Rh blood group, CcEe antigens (RHCE), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC222563L4 | Lenti ORF clone of Human Rh blood group, CcEe antigens (RHCE), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
RG222563 | RHCE (tGFP-tagged) - Human Rh blood group, CcEe antigens (RHCE), transcript variant 3 |
CNY 4,370.00 |