United States
Germany
Japan
United Kingdom
China
CCL14 (NM_032962) Human Untagged Clone
CAT＃: SC309560
CCL14 (untagged)-Human chemokine (C-C motif) ligand 14 (CCL14), transcript variant 2
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CC-1; CC-3; CKB1; HCC-1; HCC-1(1-74); HCC-1/HCC-3; HCC-3; MCIF; NCC-2; NCC2; SCYA14; SCYL2; SY14 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_032962, the custom clone sequence may differ by one or more nucleotides
ATGAAGATCTCCGTGGCTGCCATTCCCTTCTTCCTCCTCATCACCATCGCCCTAGGGACC AAGACTGAATCCTCCTCACAAACTGGGGGGAAACCGAAGGTTGTTAAAATACAGCTAAAG TTGGTGGGGGGACCTTACCACCCCTCAGAGTGCTGCTTCACCTACACTACCTACAAGATC CCGCGTCAGCGGATTATGGATTACTATGAGACCAACAGCCAGTGCTCCAAGCCCGGAATT GTCTTCATCACCAAAAGGGGCCATTCCGTCTGTACCAACCCCAGTGACAAGTGGGTCCAG GACTATATCAAGGACATGAAGGAGAACTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_032962 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_032962.2, NP_116738.1 |
| RefSeq Size | 1392 bp |
| RefSeq ORF | 579 bp |
| Locus ID | 6358 |
| UniProt ID | Q16627 |
| Protein Families | Druggable Genome, Secreted Protein |
| Protein Pathways | Chemokine signaling pathway, Cytokine-cytokine receptor interaction |
| Gene Summary | This gene, chemokine (C-C motif) ligand 14, is one of several CC cytokine genes clustered on 17q11.2. The CC cytokines are secreted proteins characterized by two adjacent cysteines. The cytokine encoded by this gene induces changes in intracellular calcium concentration and enzyme release in monocytes. Multiple transcript variants encoding different isoforms have been found for this gene. Read-through transcripts are also expressed that include exons from the upstream cytokine gene, chemokine (C-C motif) ligand 15, and are represented as GeneID: 348249. [provided by RefSeq, Dec 2009] Transcript Variant: This variant (2, also known as CCL14b) represents the longer transcript and encodes the longer isoform (2). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC214541 | CCL14 (Myc-DDK-tagged)-Human chemokine (C-C motif) ligand 14 (CCL14), transcript variant 2 |
CNY 3,990.00 |
|
| RC214541L3 | Lenti-ORF clone of CCL14 (Myc-DDK-tagged)-Human chemokine (C-C motif) ligand 14 (CCL14), transcript variant 2 |
CNY 5,890.00 |
|
| RC214541L4 | Lenti-ORF clone of CCL14 (mGFP-tagged)-Human chemokine (C-C motif) ligand 14 (CCL14), transcript variant 2 |
CNY 5,890.00 |
|
| RG214541 | CCL14 (tGFP-tagged) - Human chemokine (C-C motif) ligand 14 (CCL14), transcript variant 2 |
CNY 4,370.00 |
