CABYR (NM_153770) Human Untagged Clone

CAT#: SC309643

CABYR (untagged)-Human calcium binding tyrosine-(Y)-phosphorylation regulated (CABYR), transcript variant 6



  "NM_153770" in other vectors (6)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


CABYR Antibody - middle region
    • 100 ul

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CABYRa; CABYRc; CABYRc/d; CABYRe; CBP86; CT88; FSP-2; FSP2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC309643 representing NM_153770.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGATTTCTTCAAAGCCCAGACTTGTCGTACCCTATGGCCTCAAGACTCTGCTCGAGGGAATTAGCAGA
GCTGTTCTCAAAACCAACCCATCAAACATCAACCAGTTTGCAGCAGCTTATTTTCAAGAACTTACTATG
TATAGAGGGAATACTACTATGGATATAAAAGATCTGGTTAAACAATTTCATCAGATTAAAGTAGAGAAA
TGGTCAGAAGGAACGACACCACAGAAGAAATTAGAATGTTTAAAAGAACCAGGAAAAACATCTGTAGAA
TCTAAAGTACCTACCCAGATGGAAAAATCTACAGACACAGACGAGGACAATGTAACCAGAACAGAATAT
AGTGACAAAACCACCCAGTTTCCATCAGTTTATGCTGTGCCAGGCACTGAGCAAACGGAAGCAGTTGGT
GGTCTTTCTTCCAAACCAGCCACCCCTAAGACTACTACCCCACCCTCATCACCACCTCCAACAGCTGTC
TCACCAGAGTTTGCCTACGTCCCAGCTGACCCAGCTCAGCTTGCTGCTCAGATGTTAGAAGATGTAGCT
AAAAAAAGTTCAGGATCTGGTGACAAATGTGCTCCCTTTGGAAGTTACGGTATTGCTGGGGAGGTAACC
GTGACTACTGCTCACAAACGTCGCAAAGCAGAAACTGAAAACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_153770
Insert Size 666 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_153770.2
RefSeq Size 951 bp
RefSeq ORF 666 bp
Locus ID 26256
UniProt ID O75952
MW 24 kDa
Gene Summary To reach fertilization competence, spermatozoa undergo a series of morphological and molecular maturational processes, termed capacitation, involving protein tyrosine phosphorylation and increased intracellular calcium. The protein encoded by this gene localizes to the principal piece of the sperm flagellum in association with the fibrous sheath and exhibits calcium-binding when phosphorylated during capacitation. A pseudogene on chromosome 3 has been identified for this gene. Alternatively spliced transcript variants encoding distinct protein isoforms have been found for this gene. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (6) has a alternate splice junction in the coding region, which results in a downstream translation stop codon, compared to variant 1. The encoded isoform (e) is shorter and has a distinct C-terminus, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...