MCG10 (PCBP4) (NM_033010) Human Untagged Clone

CAT#: SC309680

PCBP4 (untagged)-Human poly(rC) binding protein 4 (PCBP4), transcript variant 4



  "NM_033010" in other vectors (6)

CNY 7,220.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal MCG10 Antibody
    • 100 ug

CNY 5,808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CBP; LIP4; MCG10
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_033010, the custom clone sequence may differ by one or more nucleotides
ATGAGCGGCTCGGACGGGGGACTGGAGGAGGAGCCAGAGCTCAGCATCACCCTCACGCTG
CGGATGCTGATGCACGGGAAGGAAGTGGGCAGCATCATCGGGAAGAAGGGCGAGACTGTA
AAGCGAATCCGGGAGCAGAGCAGTGCCCGGATCACCATCTCCGAGGGCTCCTGCCCTGAA
CGCATCACCACCATCACCGGGTCTACAGCAGCTGTCTTCCATGCAGTCTCCATGATTGCT
TTCAAACTGGATGAGGACCTTTGTGCTGCTCCTGCAAATGGTGGAAATGTCTCCAGGCCT
CCAGTGACCCTGCGCCTTGTCATCCCTGCCAGTCAGTGTGGCTCACTGATTGGGAAGGCT
GGCACCAAGATCAAGGAGATCCGAGAGACTACGGGTGCCCAGGTACAGGTGGCAGGGGAC
CTGCTCCCCAACTCCACAGAGCGAGCTGTTACGGTATCTGGGGTGCCTGATGCCATCATC
CTGTGTGTGCGCCAGATCTGCGCTGTTATCCTGGAGTCCCCACCCAAAGGAGCCACTATC
CCCTACCATCCGAGCCTCTCCCTAGGTACTGTTCTTCTCTCTGCCAACCAGGGCTTCTCT
GTCCAGGGTCAGTATGGGGCTGTGACCCCAGCTGAGGTCACCAAGCTCCAGCAGCTCTCA
AGCCATGCGGTCCCCTTTGCCACACCCAGCGTGGTGCCAGGACTGGATCCCGGCACACAG
ACCAGCTCACAGGAGTTCTTGGTTCCCAACGATTTGATTGGCTGTGTGATCGGGCGCCAG
GGCAGCAAGATCAGCGAGATCCGGCAGATGTCAGGGGCACATATCAAGATCGGGAACCAA
GCAGAGGGCGCTGGGGAGCGGCATGTCACCATCACTGGCTCTCCGGTCTCCATCGCCCTG
GCCCAGTACCTCATCACTGCCTGTCTAGAGACGGCCAAGTCTACCTCTGGGGGGACGCCC
AGCTCGGCCCCCGCAGACCTGCCTGCCCCCTTCTCGCCACCCCTGACGGCCCTGCCCACA
GCTCCCCCTGGCCTGCTGGGCACACCCTATGCCATCTCCCTCTCCAACTTCATCGGCCTC
AAGCCCATGCCCTTCTTGGCTTTACCACCTGCTTCCCCAGGGCCGCCGCCGGGCTTGGCG
GCCTACACTGCCAAGATGGCAGCAGCTAATGGGAGCAAGAAGGCTGAGCGGCAGAAATTC
TCCCCCTACTGA
Restriction Sites Please inquire     
ACCN NM_033010
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_033010.1, NP_127503.1
RefSeq Size 1962 bp
RefSeq ORF 1212 bp
Locus ID 57060
UniProt ID P57723
Domains KH
Gene Summary This gene encodes a member of the KH-domain protein subfamily. Proteins of this subfamily, also referred to as alpha-CPs, bind to RNA with a specificity for C-rich pyrimidine regions. Alpha-CPs play important roles in post-transcriptional activities and have different cellular distributions. This gene is induced by the p53 tumor suppressor, and the encoded protein can suppress cell proliferation by inducing apoptosis and cell cycle arrest in G(2)-M. This gene's protein is found in the cytoplasm, yet it lacks the nuclear localization signals found in other subfamily members. Multiple alternatively spliced transcript variants have been described, but the full-length nature for only some has been determined. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (4) differs in the 5' UTR, and includes an additional in-frame exon in the central coding region, compared to variant 1. The 5' UTR may be incomplete due to lack of 5'-complete transcript support for this variant, and the presence of alternative splicing choices further upstream. The encoded isoform (c) is longer than isoform a. Variants 3, 4 and 5 encode the same isoform.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...