United States
Germany
Japan
United Kingdom
China
MURF2 (TRIM55) (NM_184087) Human Untagged Clone
CAT＃: SC309694
TRIM55 (untagged)-Human tripartite motif containing 55 (TRIM55), transcript variant 4
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | MURF-2; muRF2; RNF29 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_184087, the custom clone sequence may differ by one or more nucleotides
ATGAGCGCATCTCTGAATTACAAATCTTTTTCCAAAGAGCAGCAGACCATGGATAACTTA GAGAAGCAACTCATCTGTCCCATCTGCTTAGAGATGTTCACGAAACCTGTGGTGATTCTC CCTTGTCAGCACAACCTGTGTAGGAAATGTGCCAGTGATATTTTCCAGGCCTCTAACCCG TATTTGCCCACAAGAGGAGGTACCACCATGGCATCAGGGGGCCGATTCCGCTGCCCATCC TGTAGACATGAAGTGGTTTTGGATAGACATGGGGTATATGGACTTCAGAGGAACCTGCTG GTGGAAAATATCATTGACATCTACAAGCAGGAGTCCACCAGGCCAGAAAAGAAATCCGAC CAGCCCATGTGCGAGGAACATGAAGAGGAGCGCATCAACATCTACTGTCTGAACTGCGAA GTACCCACCTGCTCTCTGTGCAAGGTGTTTGGTGCACACAAAGACTGCCAGGTGGCTCCC CTCACTCATGTGTTCCAGAGACAGAAGTCTGAGCTCAGTGATGGCATCGCCATCCTCGTG GGCAGCAACGATCGAGTCCAGGGAGTGATCAGCCAGCTGGAAGACACCTGCAAAACTATC GAGATTGGATTTGAGGCTCCTCCCCTCCAGGGACAGGCTGCAGCTCCAGCGAGTGGCAGT GGAGCTGATTCTGAGCCAGCTCGCCATATCTTCTCCTTTTCCTGGTTGAACTCCCTAAAT GAATGA |
| Restriction Sites | Please inquire |
| ACCN | NM_184087 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_184087.1, NP_908975.1 |
| RefSeq Size | 1850 bp |
| RefSeq ORF | 726 bp |
| Locus ID | 84675 |
| UniProt ID | Q9BYV6 |
| Gene Summary | The protein encoded by this gene contains a RING zinc finger, a motif known to be involved in protein-protein interactions. This protein associates transiently with microtubules, myosin, and titin during muscle sarcomere assembly. It may act as a transient adaptor and plays a regulatory role in the assembly of sarcomeres. Four alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (4) lacks four exons within the coding region compared to variant 1. The translation frame remains the same. The resulting isoform (4) lacks an internal region, as compared to isoform 1. This isoform (4) was detected specifically in cardiac muscle. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC218577 | TRIM55 (Myc-DDK-tagged)-Human tripartite motif containing 55 (TRIM55), transcript variant 4 |
CNY 3,990.00 |
|
| RC218577L3 | Lenti-ORF clone of TRIM55 (Myc-DDK-tagged)-Human tripartite motif containing 55 (TRIM55), transcript variant 4 |
CNY 5,890.00 |
|
| RC218577L4 | Lenti-ORF clone of TRIM55 (mGFP-tagged)-Human tripartite motif containing 55 (TRIM55), transcript variant 4 |
CNY 5,890.00 |
|
| RG218577 | TRIM55 (tGFP-tagged) - Human tripartite motif containing 55 (TRIM55), transcript variant 4 |
CNY 4,370.00 |
