CD200R (CD200R1) (NM_138939) Human Untagged Clone
CAT#: SC309709
CD200R1 (untagged)-Human CD200 receptor 1 (CD200R1), transcript variant 2
CNY 2,400.00
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CD200R; HCRTR2; MOX2R; OX2R |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_138939 edited
GCCACCATGCTCTGCCCTTGGAGAACTGCTAACCTAGGGCTACTGTTGATTTTGACTATC TTCTTAGTGGCCGAAGCGGAGGGTGCTGCTCAACCAAACAACTCATTAATGCTGCAAACT AGCAAGGAGAATCATGCTTTAGCTTCAAGCAGTTTATGTATGGATGAAAAACAGATTACA CAGAACTACTCGAAAGTACTCGCAGAAGTTAACACTTCATGGCCTGTAAAGATGGCTACA AATGCTGTGCTTTGTTGCCCTCCTATCGCATTAAGAAATTTGATCATAATAACATGGGAA ATAATCCTGAGAGGCCAGCCTTCCTGCACAAAAGCCTACAAGAAAGAAACAAATGAGACC AAGGAAACCAACTGTACTGATGAGAGAATAACCTGGGTCTCCAGACCTGATCAGAATTCG GACCTTCAGATTCGTACCGTGGCCATCACTCATGACGGGTATTACAGATGCATAATGGTA ACACCTGATGGGAATTTCCATCGTGGATATCACCTCCAAGTGTTAGGTAAGGAGCATCAT ATATTGAGGTATTTCACATCACCAGATTTGTGA |
Restriction Sites | Please inquire |
ACCN | NM_138939 |
Insert Size | 600 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_138939.2, NP_620385.1 |
RefSeq Size | 1025 bp |
RefSeq ORF | 567 bp |
Locus ID | 131450 |
UniProt ID | Q8TD46 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | This gene encodes a receptor for the OX-2 membrane glycoprotein. Both the receptor and substrate are cell surface glycoproteins containing two immunoglobulin-like domains. This receptor is restricted to the surfaces of myeloid lineage cells and the receptor-substrate interaction may function as a myeloid downregulatory signal. Mouse studies of a related gene suggest that this interaction may control myeloid function in a tissue-specific manner. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) includes an alternate exon in the coding region, compared to variant 1. This results in a frameshift and early stop codon, as well as loss of an immunoglobulin and transmembrane domain in the protein (isoform b), compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218649 | CD200R1 (Myc-DDK-tagged)-Human CD200 receptor 1 (CD200R1), transcript variant 2 |
CNY 3,990.00 |
|
RC218649L3 | Lenti-ORF clone of CD200R1 (Myc-DDK-tagged)-Human CD200 receptor 1 (CD200R1), transcript variant 2 |
CNY 5,890.00 |
|
RC218649L4 | Lenti-ORF clone of CD200R1 (mGFP-tagged)-Human CD200 receptor 1 (CD200R1), transcript variant 2 |
CNY 5,890.00 |
|
RG218649 | CD200R1 (tGFP-tagged) - Human CD200 receptor 1 (CD200R1), transcript variant 2 |
CNY 4,370.00 |