Emi1 (FBXO5) (NM_012177) Human Untagged Clone

CAT#: SC310377

FBXO5 (untagged)-Human F-box protein 5 (FBXO5), transcript variant 1



  "NM_012177" in other vectors (6)

CNY 7,220.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
Rabbit Polyclonal Anti-FBXO5 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms EMI1; FBX5; Fbxo31
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC310377 representing NM_012177.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGCCGGCGCCCCTGCAGCTGCGCCCTACGGCCACCCCGCTGCTCCTGCAGCGCCAGCCCCAGCGCA
GTGACAGCCGCCGGGCGCCCTCGACCCTCGGATAGTTGTAAAGAAGAAAGTTCTACCCTTTCTGTCAAA
ATGAAGTGTGATTTTAATTGTAACCATGTTCATTCCGGACTTAAACTGGTAAAACCTGATGACATTGGA
AGACTAGTTTCCTACACCCCTGCATATTTGGAAGGTTCCTGTAAAGACTGCATTAAAGACTATGAAAGG
CTGTCATGTATTGGGTCACCGATTGTGAGCCCTAGGATTGTACAACTTGAAACTGAAAGCAAGCGCTTG
CATAACAAGGAAAATCAACATGTGCAACAGACACTTAATAGTACAAATGAAATAGAAGCACTAGAGACC
AGTAGACTTTATGAAGACAGTGGCTATTCCTCATTTTCTCTACAAAGTGGCCTCAGTGAACATGAAGAA
GGTAGCCTCCTGGAGGAGAATTTCGGTGACAGTCTACAATCCTGCCTGCTACAAATACAAAGCCCAGAC
CAATATCCCAACAAAAACTTGCTGCCAGTTCTTCATTTTGAAAAAGTGGTTTGTTCAACATTAAAAAAG
AATGCAAAACGAAATCCTAAAGTAGATCGGGAGATGCTGAAGGAAATTATAGCCAGAGGAAATTTTAGA
CTGCAGAATATAATTGGCAGAAAAATGGGCCTAGAATGTGTAGATATTCTCAGCGAACTCTTTCGAAGG
GGACTCAGACATGTCTTAGCAACTATTTTAGCACAACTCAGTGACATGGACTTAATCAATGTGTCTAAA
GTGAGCACAACTTGGAAGAAGATCCTAGAAGATGATAAGGGGGCATTCCAGTTGTACAGTAAAGCAATA
CAAAGAGTTACCGAAAACAACAATAAATTTTCACCTCATGCTTCAACCAGAGAATATGTTATGTTCAGA
ACCCCACTGGCTTCTGTTCAGAAATCAGCAGCCCAGACTTCTCTCAAAAAAGATGCTCAAACCAAGTTA
TCCAATCAAGGTGATCAGAAAGGTTCTACTTATAGTCGACACAATGAATTCTCTGAGGTTGCCAAGACA
TTGAAAAAGAACGAAAGCCTCAAAGCCTGTATTCGCTGTAATTCACCTGCAAAATATGATTGCTATTTA
CAACGGGCAACCTGCAAACGAGAAGGCTGTGGATTTGATTATTGTACGAAGTGTCTCTGTAATTATCAT
ACTACTAAAGACTGTTCAGATGGCAAGCTCCTCAAAGCCAGTTGTAAAATAGGTCCCCTGCCTGGTACA
AAGAAAAGCAAAAAGAATTTACGAAGATTGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_012177
Insert Size 1344 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_012177.3
RefSeq Size 2109 bp
RefSeq ORF 1344 bp
Locus ID 26271
UniProt ID Q9UKT4
Domains F-box
Protein Families Druggable Genome
Protein Pathways Oocyte meiosis
MW 50.1 kDa
Gene Summary This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. This protein is similar to xenopus early mitotic inhibitor-1 (Emi1), which is a mitotic regulator that interacts with Cdc20 and inhibits the anaphase promoting complex. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Dec 2008]
Transcript Variant: This variant (1) represents the shorter transcript but encodes the longer isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...