HAT1 (NM_003642) Human Untagged Clone

CAT#: SC310414

HAT1 (untagged)-Human histone acetyltransferase 1 (HAT1), transcript variant 1



  "NM_003642" in other vectors (2)

CNY 6,750.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
KAT1 Rabbit monoclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms KAT1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_003642, the custom clone sequence may differ by one or more nucleotides
ATGGCGGGATTTGGTGCTATGGAGAAATTTTTGGTAGAATATAAGAGTGCAGTGGAGAAG
AAACTGGCAGAGTACAAATGTAACACCAACACAGCAATTGAACTAAAATTAGTTCGTTTT
CCTGAAGATCTTGAAAATGACATTAGAACTTTCTTTCCTGAGTATACCCATCAACTCTTT
GGGGATGATGAAACTGCTTTTGGTTACAAGGGTCTAAAGATCCTGTTATACTATATTGCT
GGTAGCCTGTCAACAATGTTCCGTGTTGAATATGCATCTAAAGTTGATGAGAACTTTGAC
TGTGTAGAGGCAGATGATGTTGAGGGCAAAATTAGACAAATCATTCCACCTGGATTTTGC
ACAAACACGAATGATTTCCTTTCTTTACTGGAAAAGGAAGTTGATTTCAAGCCATTCGGA
ACCTTACTTCATACCTACTCAGTTCTCAGTCCAACAGGAGGAGAAAACTTTACCTTTCAG
ATATATAAGGCTGACATGACATGTAGAGGCTTTCGAGAATATCATGAAAGGCTTCAGACC
TTTTTGATGTGGTTTATTGAAACTGCTAGCTTTATTGACGTGGATGATGAAAGATGGCAC
TACTTTCTAGTATTTGAGAAGTATAATAAGGATGGAGCTACGCTCTTTGCGACCGTAGGC
TACATGACAGTCTATAATTACTATGTGTACCCAGACAAAACCCGGCCACGTGTAAGTCAG
ATGCTGATTTTGACTCCATTTCAAGGTCAAGGCCATGGTGCTCAACTTCTTGAAACAGTT
CATAGATACTACACTGAATTTCCTACAGTTCTTGATATTACAGCGGAAGATCCATCCAAA
AGCTATGTGAAATTACGAGACTTTGTGCTTGTGAAGCTTTGTCAAGATTTGCCCTGTTTT
TCCCGGGAAAAATTAATGCAAGGATTCAATGAAGATATGGCGATAGAGGCACAACAGAAG
TTCAAAATAAATAAGCAACACGCTAGAAGGGTTTATGAAATTCTTCGACTACTGGTAACT
GACATGAGTGATGCCGAACAATACAGAAGCTACAGACTGGATATTAAAAGAAGACTAATT
AGCCCATATAAGAAAAAGCAGAGAGATCTTGCTAAGATGAGAAAATGTCTCAGACCAGAA
GAACTGACAAACCAGATGAACCAAATAGAAATAAGCATGCAACATGAACAGCTGGAAGAG
AGTTTTCAGGAACTAGTGGAAGATTACCGGCGTGTTATTGAACGACTTGCTCAAGAGTAA
Restriction Sites Please inquire     
ACCN NM_003642
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_003642.2, NP_003633.1
RefSeq Size 1672 bp
RefSeq ORF 1260 bp
Locus ID 8520
UniProt ID O14929
Protein Families Druggable Genome
Gene Summary The protein encoded by this gene is a type B histone acetyltransferase (HAT) that is involved in the rapid acetylation of newly synthesized cytoplasmic histones, which are in turn imported into the nucleus for de novo deposition onto nascent DNA chains. Histone acetylation, particularly of histone H4, plays an important role in replication-dependent chromatin assembly. Specifically, this HAT can acetylate soluble but not nucleosomal histone H4 at lysines 5 and 12, and to a lesser degree, histone H2A at lysine 5. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Jun 2009]
Transcript Variant: This variant (1) represents the longer transcript and encodes the functional protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...