Gasdermin like (GSDMB) (NM_018530) Human Untagged Clone

CAT#: SC310444

GSDMB (untagged)-Human gasdermin B (GSDMB), transcript variant 2



  "NM_018530" in other vectors (4)

SC310444 is the updated version of SC113422.

CNY 6,370.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
Rabbit Polyclonal Anti-GSDML Antibody
    • 50 ug

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GSDMB-1; GSDML; PP4052; PRO2521
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_018530, the custom clone sequence may differ by one or more nucleotides
ATGTTCAGCGTATTTGAGGAAATCACAAGAATTGTAGTTAAGGAGATGGATGCTGGAGGG
GATATGATTGCCGTTAGAAGCCTTGTTGATGCTGATAGATTCCGCTGCTTCCATCTGGTG
GGGGAGAAGAGAACTTTCTTTGGATGCCGGCACTACACAACAGGCCTCACCCTGATGGAC
ATTCTGGACACAGATGGGGACAAGTGGTTAGATGAACTGGATTCTGGGCTCCAAGGTCAA
AAGGCTGAGTTTCAAATTCTGGATAATGTAGACTCAACGGGAGAGTTGATAGTGAGATTA
CCCAAAGAAATAACAATTTCAGGCAGTTTCCAGGGCTTCCACCATCAGAAAATCAAGATA
TCGGAGAACCGGATATCCCAGCAGTATCTGGCTACCCTTGAAAACAGGAAGCTGAAGAGG
GAACTACCCTTTTCATTCCGATCAATTAATACGAGAGAAAACCTGTATCTGGTGACAGAA
ACTCTGGAGACGGTAAAGGAGGAAACCCTGAAAAGCGACCGGCAATATAAATTTTGGAGC
CAGATCTCTCAGGGCCATCTCAGCTATAAACACAAGGGCCAAAGGGAAGTGACCATCCCC
CCAAATCGGGTCCTGAGCTATCGAGTAAAGCAGCTTGTCTTCCCCAACAAGGAGACGATG
AGAAAGTCTTTGGGTTCGGAGGATTCCAGAAACATGAAGGAGAAGTTGGAGGACATGGAG
AGTGTCCTCAAGGACCTGACAGAGGAGAAGAGAAAAGATGTGCTAAACTCCCTCGCTAAG
TGCCTCGGCAAGGAGGATATTCGGCAGGATCTAGAGCAAAGAGTATCTGAGGTCCTGATT
TCCGGGGAGCTACACATGGAGGACCCAGACAAGCCTCTCCTAAGCAGCCTTTTTAATGCT
GCTGGGGTCTTGGTAGAAGCGCGTGCAAAAGCCATTCTGGACTTCCTGGATGCCCTGCTA
GAGCTGTCTGAAGAGCAGCAGTTTGTGGCTGAGGCCCTGGAGAAGGGGACCCTTCCTCTG
TTGAAGGACCAGGTGAAATCTGTCATGGAGCAGAACTGGGATGAGCTGGCCAGCAGTCCT
CCTGACATGGACTATGACCCTGAGGCACGAATTCTCTGTGCGCTGTATGTTGTTGTCTCT
ATCCTGCTGGAGCTGGCTGAGGGGCCTACCTCTGTCTCTTCCTAA
Restriction Sites Please inquire     
ACCN NM_018530
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_018530.1, NP_061000.1
RefSeq Size 1646 bp
RefSeq ORF 1185 bp
Locus ID 55876
UniProt ID Q8TAX9
Domains DFNA5
Gene Summary This gene encodes a member of the gasdermin-domain containing protein family. Other gasdermin-family genes are implicated in the regulation of apoptosis in epithelial cells, and are linked to cancer. Alternative splicing and the use of alternative promoters results in multiple transcript variants. Additional variants have been described, but they are candidates for nonsense-mediated mRNA decay (NMD) and are unlikely to be protein-coding. [provided by RefSeq, Nov 2016]
Transcript Variant: This variant (2) lacks two alternate in-frame exons in the central coding region and uses an alternate 5' UTR, compared to variant 3. The resulting isoform (2) lacks an internal segment, compared to isoform 3. The 5' end of this transcript contains long terminal repeat (LTR) sequence and initiates from an LTR promoter.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...