RNF14 (NM_183398) Human Untagged Clone
CAT#: SC310517
RNF14 (untagged)-Human ring finger protein 14 (RNF14), transcript variant 2
"NM_183398" in other vectors (4)
CNY 7,220.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ARA54; HFB30; HRIHFB2038; TRIAD2 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_183398, the custom clone sequence may differ by one or more nucleotides
ATGCAATTTCTTAAGGAAGAGACCCTAGCATACTTGAATATTGTCTCTCCTTTTGAGCTC AAGATTGGTTCTCAGAAAAAAGTGCAGAGAAGGACAGCTCAAGCTTCTCCCAACACAGAG CTAGATTTTGGAGGAGCTGCTGGATCTGATGTAGACCAAGAGGAAATTGTGGATGAGAGA GCAGTGCAGGATGTGGAATCACTGTCAAATCTGATCCAGGAAATCTTGGACTTTGATCAA GCTCAGCAGATAAAATGCTTTAATAGTAAATTGTTCCTGTGCAGTATCTGTTTCTGTGAG AAGCTGGGTAGTGAATGCATGTACTTCTTGGAGTGCAGGCATGTGTACTGCAAAGCCTGT CTGAAGGACTACTTTGAAATCCAGATCAGAGATGGCCAGGTTCAATGCCTCAACTGCCCA GAACCAAAGTGCCCTTCGGTGGCCACTCCTGGTCAGGTCAAAGAGTTAGTGGAAGCAGAG TTATTTGCCCGTTATGACCGCCTTCTCCTCCAGTCCTCCTTGGACCTGATGGCAGATGTG GTGTACTGCCCCCGGCCGTGCTGCCAGCTGCCTGTGATGCAGGAACCTGGCTGCACCATG GGTATCTGCTCCAGCTGCAATTTTGCCTTCTGTACTTTGTGCAGGTTGACCTACCATGGG GTCTCCCCATGTAAGGTGACTGCAGAGAAATTAATGGACTTACGAAATGAATACCTGCAA GCGGATGAGGCTAATAAAAGACTTTTGGATCAAAGGTATGGTAAGAGAGTGATTCAGAAG GCACTGGAAGAGATGGAAAGTAAGGAGTGGCTAGAGAAGAACTCAAAGAGCTGCCCATGT TGTGGAACTCCCATAGAGAAATTAGACGGATGTAACAAGATGACATGTACTGGCTGTATG CAATATTTCTGTTGGATTTGCATGGGTTCTCTCTCTAGAGCAAACCCTTACAAACATTTC AATGACCCTGGTTCACCATGTTTTAACCGGCTGTTTTATGCTGTGGATGTTGACGACGAT ATTTGGGAAGATGAGGTAGAAGACTAG |
Restriction Sites | Please inquire |
ACCN | NM_183398 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_183398.1, NP_899645.1 |
RefSeq Size | 2992 bp |
RefSeq ORF | 1047 bp |
Locus ID | 9604 |
UniProt ID | Q9UBS8 |
Protein Families | Druggable Genome, Transcription Factors |
Gene Summary | The protein encoded by this gene contains a RING zinc finger, a motif known to be involved in protein-protein interactions. This protein interacts with androgen receptor (AR) and may function as a coactivator that induces AR target gene expression in prostate. A dominant negative mutant of this gene has been demonstrated to inhibit the AR-mediated growth of prostate cancer. This protein also interacts with class III ubiquitin-conjugating enzymes (E2s) and may act as a ubiquitin-ligase (E3) in the ubiquitination of certain nuclear proteins. Six alternatively spliced transcript variants encoding two distinct isoforms have been reported. [provided by RefSeq, Jan 2011] Transcript Variant: This variant (2) lacks an exon compared to variant 1. The translation begins at a downstream start codon and results in an isoform (2) that has a shorter N-terminus, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC223438 | RNF14 (Myc-DDK-tagged)-Human ring finger protein 14 (RNF14), transcript variant 2 |
CNY 4,750.00 |
|
RC223438L3 | Lenti-ORF clone of RNF14 (Myc-DDK-tagged)-Human ring finger protein 14 (RNF14), transcript variant 2 |
CNY 6,650.00 |
|
RC223438L4 | Lenti-ORF clone of RNF14 (mGFP-tagged)-Human ring finger protein 14 (RNF14), transcript variant 2 |
CNY 6,650.00 |
|
RG223438 | RNF14 (tGFP-tagged) - Human ring finger protein 14 (RNF14), transcript variant 2 |
CNY 5,230.00 |