delta Sarcoglycan (SGCD) (NM_000337) Human Untagged Clone

CAT#: SC310566

SGCD (untagged)-Human sarcoglycan, delta (35kDa dystrophin-associated glycoprotein) (SGCD), transcript variant 1



  "NM_000337" in other vectors (5)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
SGCD mouse monoclonal antibody,clone OTI3D9
    • 100 ul

CNY 1,999.00
CNY 3,340.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms 35DAG; CMD1L; DAGD; LGMDR6; SG-delta; SGCDP; SGD
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC310566 representing NM_000337.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGATGCCTCAGGAGCAGTACACTCACCACCGGAGCACCATGCCTGGCTCTGTGGGGCCACAGGTATAC
AAGGTGGGGATTTATGGCTGGCGGAAACGATGCCTGTATTTCTTTGTCCTGCTCCTCATGATTTTAATA
CTGGTGAACTTGGCCATGACCATCTGGATTCTCAAAGTCATGAACTTCACAATTGATGGAATGGGAAAC
CTGAGGATCACAGAAAAAGGTCTAAAGCTAGAAGGAGACTCTGAATTCTTACAACCTCTCTACGCCAAA
GAAATCCAGTCCCGACCAGGTAATGCCCTGTACTTCAAGTCTGCCAGAAATGTTACAGTGAACATTCTC
AATGACCAGACTAAAGTGCTAACTCAGCTTATAACAGGTCCAAAAGCCGTAGAAGCTTATGGTAAAAAA
TTTGAGGTAAAAACTGTTTCTGGAAAATTGCTCTTCTCTGCAGACAATAATGAAGTGGTAGTAGGAGCT
GAAAGATTACGAGTTTTAGGAGCGGAGGGCACAGTGTTCCCTAAATCTATAGAAACACCTAATGTCAGG
GCAGACCCCTTCAAAGAACTAAGGTTGGAGTCCCCAACCCGGTCTCTAGTGATGGAGGCCCCAAAAGGA
GTGGAAATCAATGCAGAAGCTGGCAATATGGAAGCCACCTGCAGGACAGAGCTGAGACTGGAATCCAAA
GATGGAGAGATTAAGTTAGATGCTGCGAAAATCAGGCTACCTAGACTGCCTCATGGATCCTACACGCCT
ACAGGAACGAGGCAGAAGGTCTTCGAGATCTGCGTCTGCGCCAATGGGAGATTATTCCTGTCTCAGGCA
GGAGCTGGGTCCACTTGTCAGATAAACACAAGTGTCTGCCTCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_000337
Insert Size 873 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_000337.5
RefSeq Size 9805 bp
RefSeq ORF 873 bp
Locus ID 6444
UniProt ID Q92629
Domains sarcoglycan
Protein Families Transmembrane
Protein Pathways Arrhythmogenic right ventricular cardiomyopathy (ARVC), Dilated cardiomyopathy, Hypertrophic cardiomyopathy (HCM), Viral myocarditis
MW 32.2 kDa
Gene Summary The protein encoded by this gene is one of the four known components of the sarcoglycan complex, which is a subcomplex of the dystrophin-glycoprotein complex (DGC). DGC forms a link between the F-actin cytoskeleton and the extracellular matrix. This protein is expressed most abundantly in skeletal and cardiac muscle. Mutations in this gene have been associated with autosomal recessive limb-girdle muscular dystrophy and dilated cardiomyopathy. Alternatively spliced transcript variants encoding distinct isoforms have been observed for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1, also known as SGCD1), encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...