CELA1 (NM_001971) Human Untagged Clone
CAT#: SC310592
CELA1 (untagged)-Human chymotrypsin-like elastase family, member 1 (CELA1)
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ELA1 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001971, the custom clone sequence may differ by one or more nucleotides
ATGCTGGTCCTTTATGGACACAGCACCCAGGACCTTCCGGAAACCAATGCCCGCGTAGTCGGAGGGACTG AGGCCGGGAGGAATTCCTGGCCCTCTCAGATTTCCCTCCAGTACCGGTCTGGAGGTTCCCGGTATCACAC CTGTGGAGGGACCCTTATCAGACAGAACTGGGTGATGACAGCTGCTCACTGCGTGGATTACCAGAAGACT TTCCGCGTGGTGGCTGGAGACCATAACCTGAGCCAGAATGATGGCACTGAGCAGTACGTGAGTGTGCAGA AGATCGTGGTGCATCCATACTGGAACAGCGATAACGTGGCTGCCGGCTATGACATCGCCCTGCTGCGCCT GGCCCAGAGCGTTACCCTCAATAGCTATGTCCAGCTGGGTGTTCTGCCCCAGGAGGGAGCCATCCTGGCT AACAACAGTCCCTGCTACATCACAGGCTGGGGCAAGACCAAGACCAATGGGCAGCTGGCCCAGACCCTGC AGCAGGCTTACCTGCCCTCTGTGGACTACGCCATCTGCTCCAGCTCCTCCTACTGGGGCTCCACTGTGAA GAACACCATGGTGTGTGCTGGTGGAGATGGAGTTCGCTCTGGATGCCAGGGTGACTCTGGGGGCCCCCTC CATTGCTTGGTGAATGGCAAGTATTCTGTCCATGGAGTGACCAGCTTTGTGTCCAGCCGGGGCTGTAATG TCTCCAGGAAGCCTACAGTCTTCACCCAGGTCTCTGCTTACATCTCCTGGATAAATAATGTCATCGCCTC CAACTGA |
Restriction Sites | Please inquire |
ACCN | NM_001971 |
Insert Size | 800 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001971.4, NP_001962.3 |
RefSeq Size | 952 bp |
RefSeq ORF | 777 bp |
Locus ID | 1990 |
UniProt ID | Q9UNI1 |
Protein Families | Druggable Genome, Protease, Secreted Protein |
Gene Summary | Elastases form a subfamily of serine proteases that hydrolyze many proteins in addition to elastin. Humans have six elastase genes which encode the structurally similar proteins elastase 1, 2, 2A, 2B, 3A, and 3B. Unlike other elastases, pancreatic elastase 1 is not expressed in the pancreas. To date, elastase 1 expression has only been detected in skin keratinocytes. Clinical literature that describes human elastase 1 activity in the pancreas or fecal material is actually referring to chymotrypsin-like elastase family, member 3B. [provided by RefSeq, May 2009] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC210160 | CELA1 (Myc-DDK-tagged)-Human chymotrypsin-like elastase family, member 1 (CELA1) |
CNY 2,400.00 |
|
RC210160L3 | Lenti ORF clone of Human chymotrypsin-like elastase family, member 1 (CELA1), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC210160L4 | Lenti ORF clone of Human chymotrypsin-like elastase family, member 1 (CELA1), mGFP tagged |
CNY 5,890.00 |
|
RG210160 | CELA1 (tGFP-tagged) - Human chymotrypsin-like elastase family, member 1 (CELA1) |
CNY 4,370.00 |