DUSP22 (NM_020185) Human Untagged Clone
CAT#: SC310639
DUSP22 (untagged)-Human dual specificity phosphatase 22 (DUSP22)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | JKAP; JSP-1; JSP1; LMW-DSP2; LMWDSP2; MKP-x; MKPX; VHX |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC310639 representing NM_020185.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGGAATGGGATGAACAAGATCCTGCCCGGCCTGTACATCGGCAACTTCAAAGATGCCAGAGACGCG GAACAATTGAGCAAGAACAAGGTGACACATATTCTGTCTGTCCACGATAGTGCCAGGCCTATGTTGGAG GGAGTTAAATACCTGTGCATCCCAGCAGCGGATTCACCATCTCAAAACCTGACAAGACATTTCAAAGAA AGTATTAAATTCATTCACGAGTGCCGGCTCCGCGGTGAGAGCTGCCTTGTACACTGCCTGGCCGGGGTC TCCAGGAGCGTGACACTGGTGATCGCATACATCATGACCGTCACTGACTTTGGCTGGGAGGATGCCCTG CACACCGTGCGTGCTGGGAGATCCTGTGCCAACCCCAACGTGGGCTTCCAGAGACAGCTCCAGGAGTTT GAGAAGCATGAGGTCCATCAGTATCGGCAGTGGCTGAAGGAAGAATATGGAGAGAGCCCTTTGCAGGAT GCAGAAGAAGCCAAAAACATTCTGGCCGCTCCGGGAATTCTGAAGTTCTGGGCCTTTCTCAGAAGACTG TAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_020185 |
Insert Size | 555 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_020185.4 |
RefSeq Size | 1538 bp |
RefSeq ORF | 555 bp |
Locus ID | 56940 |
UniProt ID | Q9NRW4 |
Domains | DSPc |
Protein Families | Druggable Genome, Phosphatase |
MW | 20.9 kDa |
Gene Summary | Activates the Jnk signaling pathway. Dephosphorylates and deactivates p38 and stress-activated protein kinase/c-Jun N-terminal kinase (SAPK/JNK) (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks a segment of the 3' coding region and 3' UTR and includes an alternate 3' coding region, compared to variant 1. The encoded isoform (b) has a distinct C-terminus and is shorter than isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC203421 | DUSP22 (Myc-DDK-tagged)-Human dual specificity phosphatase 22 (DUSP22) |
CNY 2,400.00 |
|
RC203421L1 | Lenti ORF clone of Human dual specificity phosphatase 22 (DUSP22), Myc-DDK-tagged |
CNY 4,800.00 |
|
RC203421L2 | Lenti ORF clone of Human dual specificity phosphatase 22 (DUSP22), mGFP tagged |
CNY 5,890.00 |
|
RC203421L3 | Lenti ORF clone of Human dual specificity phosphatase 22 (DUSP22), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC203421L4 | Lenti ORF clone of Human dual specificity phosphatase 22 (DUSP22), mGFP tagged |
CNY 5,890.00 |
|
RG203421 | DUSP22 (tGFP-tagged) - Human dual specificity phosphatase 22 (DUSP22) |
CNY 4,000.00 |