D4S234E (NSG1) (NM_001040101) Human Untagged Clone

CAT#: SC310958

NSG1 (untagged)-Human DNA segment on chromosome 4 (unique) 234 expressed sequence (D4S234E), transcript variant 2



  "NM_001040101" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit polyclonal anti-NSG1 antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms D4S234; D4S234E; NEEP21; P21
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC310958 representing NM_001040101.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGTGAAGTTGGGGAACAATTTCGCAGAGAAGGGCACCAAGCAGCCGCTGCTGGAGGATGGCTTCGAC
ACCATTCCCCTGATGACGCCCCTCGATGTCAATCAGCTGCAGTTCCCGCCCCCGGATAAGGTGGTCGTG
AAAACTAAGACCGAGTATGAACCTGACCGCAAGAAAGGGAAAGCACGTCCTCCCCAAATTGCTGAGTTC
ACCGTCAGCATCACGGAGGGTGTCACCGAGAGGTTTAAGGTCTCCGTGTTGGTCCTCTTCGCCCTGGCC
TTCCTCACCTGCGTCGTCTTCCTGGTTGTCTACAAGGTGTACAAGTATGACCGCGCCTGCCCCGATGGG
TTCGTCCTCAAGAACACCCAGTGCATCCCAGAAGGCTTGGAGAGCTACTACGCGGAGCAAGACTCCAGT
GCCCGGGAGAAATTTTACACAGTCATAAACCACTACAACCTGGCCAAGCAGAGCATCACGCGCTCCGTA
TCGCCCTGGATGTCAGTTCTGTCAGAAGAGAAGCTGTCCGAGCAGGAGACTGAAGCGGCTGAGAAGTCA
GCTTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001040101
Insert Size 558 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001040101.1
RefSeq Size 2635 bp
RefSeq ORF 558 bp
Locus ID 27065
UniProt ID P42857
Protein Families Druggable Genome, Transmembrane
MW 20.9 kDa
Gene Summary Plays a role in the recycling mechanism in neurons of multiple receptors, including AMPAR, APP and L1CAM and acts at the level of early endosomes to promote sorting of receptors toward a recycling pathway. Regulates sorting and recycling of GRIA2 through interaction with GRIP1 and then contributes to the regulation of synaptic transmission and plasticity by affecting the recycling and targeting of AMPA receptors to the synapse (By similarity). Is required for faithful sorting of L1CAM to axons by facilitating trafficking from somatodendritic early endosome or the recycling endosome (By similarity). In an other hand, induces apoptosis via the activation of CASP3 in response to DNA damage (PubMed:20599942, PubMed:20878061).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 3. Variants 1, 2, and 3 all encode the same isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...