D4S234E (NSG1) (NM_001040101) Human Untagged Clone
CAT#: SC310958
NSG1 (untagged)-Human DNA segment on chromosome 4 (unique) 234 expressed sequence (D4S234E), transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | D4S234; D4S234E; NEEP21; P21 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC310958 representing NM_001040101.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGTGAAGTTGGGGAACAATTTCGCAGAGAAGGGCACCAAGCAGCCGCTGCTGGAGGATGGCTTCGAC ACCATTCCCCTGATGACGCCCCTCGATGTCAATCAGCTGCAGTTCCCGCCCCCGGATAAGGTGGTCGTG AAAACTAAGACCGAGTATGAACCTGACCGCAAGAAAGGGAAAGCACGTCCTCCCCAAATTGCTGAGTTC ACCGTCAGCATCACGGAGGGTGTCACCGAGAGGTTTAAGGTCTCCGTGTTGGTCCTCTTCGCCCTGGCC TTCCTCACCTGCGTCGTCTTCCTGGTTGTCTACAAGGTGTACAAGTATGACCGCGCCTGCCCCGATGGG TTCGTCCTCAAGAACACCCAGTGCATCCCAGAAGGCTTGGAGAGCTACTACGCGGAGCAAGACTCCAGT GCCCGGGAGAAATTTTACACAGTCATAAACCACTACAACCTGGCCAAGCAGAGCATCACGCGCTCCGTA TCGCCCTGGATGTCAGTTCTGTCAGAAGAGAAGCTGTCCGAGCAGGAGACTGAAGCGGCTGAGAAGTCA GCTTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001040101 |
Insert Size | 558 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001040101.1 |
RefSeq Size | 2635 bp |
RefSeq ORF | 558 bp |
Locus ID | 27065 |
UniProt ID | P42857 |
Protein Families | Druggable Genome, Transmembrane |
MW | 20.9 kDa |
Gene Summary | Plays a role in the recycling mechanism in neurons of multiple receptors, including AMPAR, APP and L1CAM and acts at the level of early endosomes to promote sorting of receptors toward a recycling pathway. Regulates sorting and recycling of GRIA2 through interaction with GRIP1 and then contributes to the regulation of synaptic transmission and plasticity by affecting the recycling and targeting of AMPA receptors to the synapse (By similarity). Is required for faithful sorting of L1CAM to axons by facilitating trafficking from somatodendritic early endosome or the recycling endosome (By similarity). In an other hand, induces apoptosis via the activation of CASP3 in response to DNA damage (PubMed:20599942, PubMed:20878061).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 3. Variants 1, 2, and 3 all encode the same isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC206927 | NSG1 (Myc-DDK-tagged)-Human DNA segment on chromosome 4 (unique) 234 expressed sequence (D4S234E), transcript variant 2 |
CNY 2,400.00 |
|
RC206927L3 | Lenti ORF clone of Human DNA segment on chromosome 4 (unique) 234 expressed sequence (D4S234E), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC206927L4 | Lenti ORF clone of Human DNA segment on chromosome 4 (unique) 234 expressed sequence (D4S234E), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG206927 | NSG1 (tGFP-tagged) - Human DNA segment on chromosome 4 (unique) 234 expressed sequence (D4S234E), transcript variant 2 |
CNY 4,370.00 |