MAPKAP Kinase 2 (MAPKAPK2) (NM_004759) Human Untagged Clone

CAT#: SC311111

MAPKAPK2 (untagged)-Human mitogen-activated protein kinase-activated protein kinase 2 (MAPKAPK2), transcript variant 1



  "NM_004759" in other vectors (7)

CNY 6,080.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-MAPKAPK2 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms MAPKAP-K2; MK-2; MK2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC311111 representing NM_004759.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCTGTCCAACTCCCAGGGCCAGAGCCCGCCGGTGCCGTTCCCCGCCCCGGCCCCGCCGCCGCAGCCC
CCCACCCCTGCCCTGCCGCACCCCCCGGCGCAGCCGCCGCCGCCGCCCCCGCAGCAGTTCCCGCAGTTC
CACGTCAAGTCCGGCCTGCAGATCAAGAAGAACGCCATCATCGATGACTACAAGGTCACCAGCCAGGTC
CTGGGGCTGGGCATCAACGGCAAAGTTTTGCAGATCTTCAACAAGAGGACCCAGGAGAAATTCGCCCTC
AAAATGCTTCAGGACTGCCCCAAGGCCCGCAGGGAGGTGGAGCTGCACTGGCGGGCCTCCCAGTGCCCG
CACATCGTACGGATCGTGGATGTGTACGAGAATCTGTACGCAGGGAGGAAGTGCCTGCTGATTGTCATG
GAATGTTTGGACGGTGGAGAACTCTTTAGCCGAATCCAGGATCGAGGAGACCAGGCATTCACAGAAAGA
GAAGCATCCGAAATCATGAAGAGCATCGGTGAGGCCATCCAGTATCTGCATTCAATCAACATTGCCCAT
CGGGATGTCAAGCCTGAGAATCTCTTATACACCTCCAAAAGGCCCAACGCCATCCTGAAACTCACTGAC
TTTGGCTTTGCCAAGGAAACCACCAGCCACAACTCTTTGACCACTCCTTGTTATACACCGTACTATGTG
GCTCCAGAAGTGCTGGGTCCAGAGAAGTATGACAAGTCCTGTGACATGTGGTCCCTGGGTGTCATCATG
TACATCCTGCTGTGTGGGTATCCCCCCTTCTACTCCAACCACGGCCTTGCCATCTCTCCGGGCATGAAG
ACTCGCATCCGAATGGGCCAGTATGAATTTCCCAACCCAGAATGGTCAGAAGTATCAGAGGAAGTGAAG
ATGCTCATTCGGAATCTGCTGAAAACAGAGCCCACCCAGAGAATGACCATCACCGAGTTTATGAACCAC
CCTTGGATCATGCAATCAACAAAGGTCCCTCAAACCCCACTGCACACCAGCCGGGTCCTGAAGGAGGAC
AAGGAGCGGTGGGAGGATGTCAAGGGGTGTCTTCATGACAAGAACAGCGACCAGGCCACTTGGCTGACC
AGGTTGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_004759
Insert Size 1113 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_004759.4
RefSeq Size 3534 bp
RefSeq ORF 1113 bp
Locus ID 9261
UniProt ID P49137
Domains pkinase, TyrKc, S_TKc
Protein Families Druggable Genome, Protein Kinase
Protein Pathways MAPK signaling pathway, Neurotrophin signaling pathway, VEGF signaling pathway
MW 42.2 kDa
Gene Summary This gene encodes a member of the Ser/Thr protein kinase family. This kinase is regulated through direct phosphorylation by p38 MAP kinase. In conjunction with p38 MAP kinase, this kinase is known to be involved in many cellular processes including stress and inflammatory responses, nuclear export, gene expression regulation and cell proliferation. Heat shock protein HSP27 was shown to be one of the substrates of this kinase in vivo. Two transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longer transcript but encodes the shorter isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...