DEFB105B (NM_001040703) Human Untagged Clone

CAT#: SC311207

DEFB105B (untagged)-Human defensin, beta 105B (DEFB105B)



  "NM_001040703" in other vectors (4)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BD-5; DEFB-5
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001040703, the custom clone sequence may differ by one or more nucleotides
ATGGCCCTGATCAGGAAGACATTTTATTTTCTATTTGCTATGTTCTTCATTTTGGTTCAA
CTGCCATCAGGGTGCCAGGCAGGACTTGATTTTTCCCAACCATTTCCATCAGGTGAGTTT
GCTGTCTGTGAGTCGTGCAAGCTTGGTCGGGGAAAATGCAGGAAGGAGTGCTTGGAGAAT
GAGAAGCCCGATGGAAATTGCAGGCTGAACTTTCTCTGCTGCAGACAGAGGATCTGA
Restriction Sites Please inquire     
ACCN NM_001040703
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001040703.1, NP_001035793.1
RefSeq Size 237 bp
RefSeq ORF 237 bp
Locus ID 504180
UniProt ID Q8NG35
Protein Families Transmembrane
Gene Summary Defensins form a family of antimicrobial and cytotoxic peptides made by neutrophils. Defensins are short, processed peptide molecules that are classified by structure into three groups: alpha-defensins, beta-defensins and theta-defensins. All beta-defensin genes are densely clustered in four to five syntenic chromosomal regions. Chromosome 8p23 contains at least two copies of the duplicated beta-defensin cluster. This duplication results in two identical copies of defensin, beta 105, DEFB105A and DEFB105B, in tail-to-tail orientation. This gene, DEFB105B, represents the more telomeric copy. [provided by RefSeq, Oct 2014]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...