SNX21 (NM_001042632) Human Untagged Clone
CAT#: SC311343
SNX21 (untagged)-Human sorting nexin family member 21 (SNX21), transcript variant 3
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C20orf161; dJ337O18.4; PP3993; SNX-L; SNXL |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001042632, the custom clone sequence may differ by one or more nucleotides
ATGCACCGTGGGACGCAGGAGGGTGCCATGGCCTCCCGGCTCCTGCACCGGCTGCGGCAC GCCTTGGCCGGCGACGGCCCCGGGGAGGCGGCGGCCAGTCCAGAGGCCGAGCAGTTTCCG GAGAGCTCAGAGCTGGAGGACGACGACGCCGAGGGCCTGTCCTCCCGACTCAGCGGCACC CTCAGCTTCACCAGCGCCGAGGACGACGAGGACGACGAGGACGAGGACGACGAGGAGGCT GGCCCTGACCAGCTGCCCCTCGGGGATGGGACGTCAGGAGAAGACGCAGAACGGAGCCCC CCACCTGATGGGCAGTGGGGCAGTCAGCTCCTGGCGCGGCAGCTGCAGGATTTCTGGAAG AAGTCCCGGAACACCTTGGCACCCCAGCGGCTGCTCTTCGAAGTGACCAGCGCTAACGTT GTCAAGGACCCGCCCTCCAACTCTACACCCTCGCCGTGA |
Restriction Sites | Please inquire |
ACCN | NM_001042632 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001042632.1, NP_001036097.1 |
RefSeq Size | 3166 bp |
RefSeq ORF | 459 bp |
Locus ID | 90203 |
Protein Families | Druggable Genome |
Gene Summary | This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein does not contain a coiled coil region, like some family members. The specific function of this protein has not been determined. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) uses an alternate splice site in the coding region, compared to variant 1, that results in a frameshift. The resulting isoform (c) has a shorter and distinct C-terminus that lacks a PX domain, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC223999 | SNX21 (Myc-DDK-tagged)-Human sorting nexin family member 21 (SNX21), transcript variant 3 |
CNY 3,990.00 |
|
RC223999L3 | Lenti-ORF clone of SNX21 (Myc-DDK-tagged)-Human sorting nexin family member 21 (SNX21), transcript variant 3 |
CNY 5,890.00 |
|
RC223999L4 | Lenti-ORF clone of SNX21 (mGFP-tagged)-Human sorting nexin family member 21 (SNX21), transcript variant 3 |
CNY 5,890.00 |
|
RG223999 | SNX21 (tGFP-tagged) - Human sorting nexin family member 21 (SNX21), transcript variant 3 |
CNY 4,370.00 |