CD1E (NM_001042584) Human Untagged Clone
CAT#: SC311359
CD1E (untagged)-Human CD1e molecule (CD1E), transcript variant 3
CNY 6,270.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CD1A; R2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC311359 representing NM_001042584.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCTGCTCCTGTTCCTCCTCTTCGAGGGTCTCTGCTGTCCTGGGGAAAATACAGCAGCTCCCCAGGCT CTACAATCCTATCATCTAGCAGCAGAGGAGCAGCTGTCCTTCCGCATGCTCCAAACTTCCTCCTTTGCC AACCACAGCTGGGCACACAGTGAGGGCTCAGGATGGCTGGGTGACCTGCAGACTCATGGCTGGGACACT GTCTTGGGCACCATCCGCTTTCTGAAGCCCTGGTCCCATGGAAACTTCAGCAAGCAGGAGCTGAAAAAC TTACAGTCACTGTTCCAGTTATACTTCCATAGTTTTATCCAGATAGTGCAAGCTTCTGCTGGTCAATTT CAGCTTGAATACCCCTTCGAGATCCAGATATTAGCTGGCTGTAGAATGAATGCCCCACAAATCTTCTTA AATATGGCATATCAAGGGTCAGATTTCCTGAGTTTCCAAGGAATTTCCTGGGAGCCATCTCCAGGAGCA GGGATCCGGGCCCAGAACATCTGTAAAGTGCTCAATCGCTACCTAGATATTAAGGAAATACTGCAAAGC CTTCTTGGTCACACCTGCCCTCGATTTCTAGCGGGGCTCATGGAAGCAGGGGAGTCAGAACTGAAACGG AAAGTGAAGCCAGAGGCCTGGCTGTCCTGTGGCCCCAGTCCTGGCCCTGGCCGTCTGCAGCTTGTGTGC CATGTCTCAGGATTCTACCCAAAGCCCGTGTGGGTGATGTGGATGCGGGGTGAGCAGGAGCAGCGGGGC ACTCAGCGAGGGGACGTCCTGCCTAATGCTGACGAGACATGGTGGATATTCCATCTTTCTCATCCTGAT CTGTTTGACTGTGATAGTTACCCTGGTCATATTGGTTGTAGTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001042584 |
Insert Size | 873 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001042584.2 |
RefSeq Size | 2013 bp |
RefSeq ORF | 873 bp |
Locus ID | 913 |
UniProt ID | P15812 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Hematopoietic cell lineage |
MW | 32.7 kDa |
Gene Summary | This gene encodes a member of the CD1 family of transmembrane glycoproteins, which are structurally related to the major histocompatibility complex (MHC) proteins and form heterodimers with beta-2-microglobulin. The CD1 proteins mediate the presentation of primarily lipid and glycolipid antigens of self or microbial origin to T cells. The human genome contains five CD1 family genes organized in a cluster on chromosome 1. The CD1 family members are thought to differ in their cellular localization and specificity for particular lipid ligands. The protein encoded by this gene localizes within Golgi compartments, endosomes, and lysosomes, and is cleaved into a stable soluble form. The soluble form is required for the intracellular processing of some glycolipids into a form that can be presented by other CD1 family members. Many alternatively spliced transcript variants encoding different isoforms have been described. Additional transcript variants have been found; however, their biological validity has not been determined. [provided by RefSeq, Jun 2010] Transcript Variant: This variant (3) uses an alternate splice site in the 3' coding region, compared to variant 1, that results in a frameshift. It encodes an isoform (c, also known as 3), which has a shorter and distinct C-terminus compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC211774 | CD1E (Myc-DDK-tagged)-Human CD1e molecule (CD1E), transcript variant 3 |
CNY 2,400.00 |
|
RC211774L3 | Lenti ORF clone of Human CD1e molecule (CD1E), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC211774L4 | Lenti ORF clone of Human CD1e molecule (CD1E), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
RG211774 | CD1E (tGFP-tagged) - Human CD1e molecule (CD1E), transcript variant 3 |
CNY 4,370.00 |