SMRC2 (SMARCC2) (AL833124) Human Untagged Clone
CNY 9,120.00
货期*
4周
规格
Product images
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BAF170; CRACC2; Rsc8 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for AL833124, the custom clone sequence may differ by one or more nucleotides
ATGGCGGTGCGGAAGAAGGACGGCGGCCCCAACGTGAAGTACTACGAGGCCGCGGACACC GTGACCCAGTTCGACAACGTGCGGCTGTGGCTCGGCAAGAACTACAAGAAGTATATACAA GCTGAACCACCCACCAACAAGTCCCTGTCTAGCCTGGTTGTACAGTTGCTACAATTTCAG GAAGAAGTTTTTGGCAAACATGTCAGCAATGCACCGCTCACTAAACTGCCGGTGAGTGCA GAAGTAGCAGGGAGGGTGGGGGGTGGTGGTGGTGAATCCTTCAAACTGAAGAGTTGTATT TTAAAAAAAGATTTG |
Restriction Sites | Please inquire |
ACCN | AL833124 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | AL833124.1, CAH56218.1 |
RefSeq Size | 3250 bp |
RefSeq ORF | 318 bp |
Locus ID | 6601 |
Protein Families | Transcription Factors |
Gene Summary | The protein encoded by this gene is a member of the SWI/SNF family of proteins, whose members display helicase and ATPase activities and which are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI and contains a predicted leucine zipper motif typical of many transcription factors. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...