DENND3 (AK058001) Human Untagged Clone
CNY 9,120.00
货期*
4周
规格
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for AK058001, the custom clone sequence may differ by one or more nucleotides
ATGCGCTCCTTGAGAAAGAAGAGAGAGAAGCCCAGACCAGAGCAGTGGAAGGGCCTCCCG GGGCCCCCCAGAGCGCCAGAGCCTGAGGATGTCGCCGTCCCGGGCGGCGTGGACCTCCTC ACCCTGCCGCAGCTGTGCTTCCCAGGGGGTGTGTGCGTGGCCACTGAACCTAAGGAGGAT TGCGTCCACTTCCTGGTGCTGACCGATGTCTGCGGGAATAGGACCTATGGCGTGGTGGCC CAGTACTACCGGCCCCTGCATGATGAGTACTGTTTCTACAATGGCAAAACGCACCGGGAG TGTCCTGGCTGCTTCGTGCCCTTCGCGGTGTGCGTGGTCTCCAGGTTTCCCTATTACAAC TCCCTCAAGGACTGCCTTTCCTGG |
Restriction Sites | Please inquire |
ACCN | AK058001 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | AK058001.1, BAB71630.1 |
RefSeq Size | 2056 bp |
RefSeq ORF | 387 bp |
Locus ID | 22898 |
Gene Summary | Guanine nucleotide exchange factor (GEF) activating RAB12. Promotes the exchange of GDP to GTP, converting inactive GDP-bound RAB12 into its active GTP-bound form (PubMed:20937701). Regulates autophagy in response to starvation through RAB12 activation. Starvation leads to ULK1/2-dependent phosphorylation of Ser-472 and Ser-490, which in turn allows recruitment of 14-3-3 adapter proteins and leads to up-regulation of GEF activity towards RAB12 (By similarity). Also plays a role in protein transport from recycling endosomes to lysosomes, regulating, for instance, the degradation of the transferrin receptor and of the amino acid transporter PAT4 (PubMed:20937701). Starvation also induces phosphorylation at Tyr-858, which leads to up-regulated GEF activity and initiates autophagy (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...