DENND3 (AK058001) Human Untagged Clone

CAT#: SC311965

(untagged)-Human cDNA FLJ25272 fis, clone STM05694



CNY 9,120.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
DENND3 Antibody - C-terminal region
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for AK058001, the custom clone sequence may differ by one or more nucleotides
ATGCGCTCCTTGAGAAAGAAGAGAGAGAAGCCCAGACCAGAGCAGTGGAAGGGCCTCCCG
GGGCCCCCCAGAGCGCCAGAGCCTGAGGATGTCGCCGTCCCGGGCGGCGTGGACCTCCTC
ACCCTGCCGCAGCTGTGCTTCCCAGGGGGTGTGTGCGTGGCCACTGAACCTAAGGAGGAT
TGCGTCCACTTCCTGGTGCTGACCGATGTCTGCGGGAATAGGACCTATGGCGTGGTGGCC
CAGTACTACCGGCCCCTGCATGATGAGTACTGTTTCTACAATGGCAAAACGCACCGGGAG
TGTCCTGGCTGCTTCGTGCCCTTCGCGGTGTGCGTGGTCTCCAGGTTTCCCTATTACAAC
TCCCTCAAGGACTGCCTTTCCTGG
Restriction Sites Please inquire     
ACCN AK058001
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq AK058001.1, BAB71630.1
RefSeq Size 2056 bp
RefSeq ORF 387 bp
Locus ID 22898
Gene Summary Guanine nucleotide exchange factor (GEF) activating RAB12. Promotes the exchange of GDP to GTP, converting inactive GDP-bound RAB12 into its active GTP-bound form (PubMed:20937701). Regulates autophagy in response to starvation through RAB12 activation. Starvation leads to ULK1/2-dependent phosphorylation of Ser-472 and Ser-490, which in turn allows recruitment of 14-3-3 adapter proteins and leads to up-regulation of GEF activity towards RAB12 (By similarity). Also plays a role in protein transport from recycling endosomes to lysosomes, regulating, for instance, the degradation of the transferrin receptor and of the amino acid transporter PAT4 (PubMed:20937701). Starvation also induces phosphorylation at Tyr-858, which leads to up-regulated GEF activity and initiates autophagy (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Customer Reviews 
Loading...