IL28 Receptor alpha (IFNLR1) (AK098257) Human Untagged Clone
CNY 9,120.00
货期*
4周
规格
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
经常一起买 (4)
IFNLR1 mouse monoclonal antibody,clone OTI8G1
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for AK098257, the custom clone sequence may differ by one or more nucleotides
ATGCTTTCAAGAGAGCATCAGCTGATACAACCTAAGGTCGCCTGGATAAGTATTTGGGTT TCTCAGGCCATAGGCAGTGCCATAGAGCTCCTAAGAGATTATGTCTTTTGTCTGAATTCA GAGTTTTTGTTTTTTGGCTGTCTCATGGAGTTTGCAGTGGCAAGCCACTTCCTTCAAAGA TTCTGTGAAATCTTGTGGCTTTCCTGCTGTGTTCCTGTGGTGGTTTTTGGAGCTAAAGTT CACGATGTGAGTTTCTACATGCTGTTCTGTCCTTCTGAGTGGGAGCTGCAAGTTAGTCCT GCCTCCTCACCACCATTTTTCCCTATTTTCAGTTTTTTGATGCTACCACAGTTTTATACC ACTTTGTTCTCAATCCCTCAGTCTCATCCTGCAGAAGCCCTTGCCTCCAACTCTATGGAG AAGAAT |
Restriction Sites | Please inquire |
ACCN | AK098257 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | AK098257.1 |
RefSeq Size | 2066 bp |
RefSeq ORF | 2066 bp |
Locus ID | 163702 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway |
Gene Summary | The protein encoded by this gene belongs to the class II cytokine receptor family. This protein forms a receptor complex with interleukine 10 receptor, beta (IL10RB). The receptor complex has been shown to interact with three closely related cytokines, including interleukin 28A (IL28A), interleukin 28B (IL28B), and interleukin 29 (IL29). The expression of all three cytokines can be induced by viral infection. The cells overexpressing this protein have been found to have enhanced responses to IL28A and IL29, but decreased response to IL28B. Three alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...