MEG3 (AK055725) Human Untagged Clone

CAT#: SC312146

(untagged)-Human cDNA FLJ31163 fis, clone KIDNE1000050



CNY 9,120.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms FP504; GTL2; LINC00023; NCRNA00023; onco-lncRNA-83; prebp1; PRO0518; PRO2160
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for AK055725, the custom clone sequence may differ by one or more nucleotides
ATGAGAAGACTTTCAATAGTAATGAAGAATCCATGGCACTCTCCTCACCCTCAAACACAT
GGCAGTCATTCACATACAGGCCCCAAAGCCACTGTTAGTGCTGCAGTAGCTCCTGTGGAC
ATTGGAAAGCCCGGAGAGGGCGTGGAAGAAATCAGCTGGCCCCCGGCAGGTTCTCTGGGG
TTTTGTGCCCAAGGCTCCTGGAGCCCTAAAAACTTTCAAAAGTTAACTCCCCACGTCCCC
ATCCTGCTTGGGTTTCTGGACTTTTCTGAGGCACCGGCAGAGGGGTCTCGTTGCTCCCTT
GAGTGTAGGGGCAGCCCTTTAACCTGGCTCCTTGAGTCCCTGCTTTTTCTGCTTCTGTTG
CCTTCTTCCTCGTCTTCCTCTCTCTCAATATCTCCCTCTCTTTGTCCCTCCCCAGTTCCT
GACCTGGCCATCCCGGGGTGCCCT
Restriction Sites Please inquire     
ACCN AK055725
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq AK055725.1, BAB70996.1
RefSeq Size 2861 bp
RefSeq ORF 447 bp
Locus ID 55384
Gene Summary This gene is a maternally expressed imprinted gene. Multiple alternatively spliced transcript variants have been transcribed from this gene and all of them are long non-coding RNAs (lncRNAs). This gene is expressed in many normal tissues, but its expression is lost in multiple cancer cell lines of various tissue origins. It inhibits tumor cell proliferation in vitro. It also interacts with the tumor suppressor p53, and regulates p53 target gene expression. Its deletion enhances angiogenesis in vivo. Many experimental evidences demonstrate that this gene is a lncRNA tumor suppressor. [provided by RefSeq, Mar 2012]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Customer Reviews 
Loading...