ST8SIA4 (NM_175052) Human Untagged Clone
CAT#: SC312288
ST8SIA4 (untagged)-Human ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4 (ST8SIA4), transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | PST; PST1; SIAT8D; ST8SIA-IV |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC312288 representing NM_175052.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCGCTCCATTAGGAAGAGGTGGACGATCTGCACAATAAGTCTGCTCCTGATCTTTTATAAGACAAAA GAAATAGCAAGAACTGAGGAGCACCAGGAGACGCAACTCATCGGAGATGGTGAATTGTCTTTGAGTCGG TCACTTGTCAATAGCTCTGATAAAATCATTCGAAAGGCTGGCTCTTCAATCTTCCAGCACAATGTAGAA GGTTGGAAAATCAATTCCTCTTTGGTCCTAGAGATAAGGAAGAACATACTTCGTTTCTTAGATGCAGAA CGAGATGTGTCAGTGGTCAAGAGCAGTTTTAAGCCTGGTGATGTCATACACTATGTGCTTGACAGGCGC CGGACACTAAACATTTCTCATGATCTACATAGCCTCCTACCTGAAGTTTCACCAATGAAGAATCGCAGG TTTAAGACCTGTGCAGTTGTTGGAAATTCTGGCATTCTGTTAGACAGTGAATGTGGAAAGGAGATTGAC AGTCACAATTTTGTAATAAGGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_175052 |
Insert Size | 507 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_175052.2 |
RefSeq Size | 1906 bp |
RefSeq ORF | 507 bp |
Locus ID | 7903 |
UniProt ID | Q92187 |
MW | 19.3 kDa |
Gene Summary | The protein encoded by this gene catalyzes the polycondensation of alpha-2,8-linked sialic acid required for the synthesis of polysialic acid, a modulator of the adhesive properties of neural cell adhesion molecule (NCAM1). The encoded protein, which is a member of glycosyltransferase family 29, is a type II membrane protein that may be present in the Golgi apparatus. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks two exons and its transcription extends past a splice site that is used in variant 1, resulting in a shorter 3' coding region and a novel 3' UTR compared to variant 1. It encodes isoform b which is truncated at the C-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215497 | ST8SIA4 (Myc-DDK-tagged)-Human ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4 (ST8SIA4), transcript variant 2 |
CNY 2,400.00 |
|
RC215497L3 | Lenti ORF clone of Human ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4 (ST8SIA4), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC215497L4 | Lenti ORF clone of Human ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4 (ST8SIA4), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG215497 | ST8SIA4 (tGFP-tagged) - Human ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4 (ST8SIA4), transcript variant 2 |
CNY 4,370.00 |
其它ST8SIA4产品