DCTN3 (AK091661) Human Untagged Clone
CAT#: SC312308
(untagged)-Human cDNA FLJ34342 fis, clone FEBRA2009986, moderately similar to Dynactin 3 (p22), dynactin light chain
CNY 9,120.00
货期*
4周
规格
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DCTN-22; DCTN22 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for AK091661, the custom clone sequence may differ by one or more nucleotides
ATGGCGGGTCTGACTGACTTGCAGCGGCTACAGGCCCGAGTGGAAGAGCTGGAGCGCTGG GTGTACGGGCCGGGCGGGGCGCGCGGCTCACGGAAGGTGGCTGACGGCCTGGTCAAGGTG CAGGTGGCTTTGGGGAACATTTCCAGCAAGAGGGAGAGGGTGAAGATTCTCTACAAAAAG ATTGAAGATCTGATCAAGTACCTGGATCCTGAGTACATCGACCGCATTGCCATACCTGAT GCCTCTAAGCTGCAATTCATCCTAGCAGGTAATGCTGGACTACATGTGTACATGCATCTG AGGATGTGGGTCGTCGGGGAGGTTAAGCACAGAGATGGCCTCTCCATCCAGTCTTCTGGT GGATACAAGCCCTGGATGCTGCTCTCTGGAATTGTGGCCTGGTTCTGGGTTGAGGATCCT ATGGATCCTCTAGTAGACATTGAGTACAGTATACCTCTGCACCAGCTGCAGGCCATGGTG CCAGCCACAGTGGGAGCTAGTCCAGTGTTCTATCAA |
Restriction Sites | Please inquire |
ACCN | AK091661 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | AK091661.1, BAC03716.1 |
RefSeq Size | 3877 bp |
RefSeq ORF | 519 bp |
Locus ID | 11258 |
Gene Summary | This gene encodes the smallest subunit of dynactin, a macromolecular complex consisting of 10 subunits ranging in size from 22 to 150 kD. Dynactin binds to both microtubules and cytoplasmic dynein. It is involved in a diverse array of cellular functions, including ER-to-Golgi transport, the centripetal movement of lysosomes and endosomes, spindle formation, cytokinesis, chromosome movement, nuclear positioning, and axonogenesis. This subunit, like most other dynactin subunits, exists only as a part of the dynactin complex. It is primarily an alpha-helical protein with very little coiled coil, and binds directly to the largest subunit (p150) of dynactin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...