PHC3 (AK023029) Human Untagged Clone

CAT#: SC312367

(untagged)-Human cDNA FLJ12967 fis, clone NT2RP2005806



CNY 9,120.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal PHC3 Antibody
    • 100 ug

CNY 5,808.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms EDR3; HPH3
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for AK023029, the custom clone sequence may differ by one or more nucleotides
ATGGATACTGAACCAAACCCGGGAACATCTTCTGTGTCAACAACAACCAGCAGTACCACC
ACCACCACCATCACCACTTCCTCCTCTCGAATGCAGCAGCCACAGATCTCTGTCTACAGT
GGTTCAGACCGACATGCTGTACAGGCATTGCATCGGCCCCCCAGCTCAGCTGCTCAGTAC
CTTCAGCAAATGTATGCAGCCCAACAACAGCACTTGATGCTGCATACTGCAGCTCTTCAG
CAGCAGCATTTAAGCAGCTCCCAGCTTCAGAGCCTTGCTGCTGTTCAGGCAAGTTTGTCC
AGCGGAAGACCATCTACATCTCCCACAGGAAGTGTCACACAGCAGTCAAGTATGTCCCAA
ACGTCTATCAACCTCTCCACTTCTCCTACACCTGCACAGTTAATAAGCCGTTCCCAGGCT
TCCAGTTCTACCAGCGGCAGTATTACCCAACAGACTATGTTACTAGGGAGTACTTCCCCT
ACCCTAACGGCAAGCCAAGCTCAAATGTATCTCCGAGCTCAAATGGTAAGATATGAGCTA
CCAAATTTTTTCAGTGTT
Restriction Sites Please inquire     
ACCN AK023029
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq AK023029.1, BAB14365.1
RefSeq Size 2427 bp
RefSeq ORF 2427 bp
Locus ID 80012
Gene Summary Component of a Polycomb group (PcG) multiprotein PRC1-like complex, a complex class required to maintain the transcriptionally repressive state of many genes, including Hox genes, throughout development. PcG PRC1 complex acts via chromatin remodeling and modification of histones; it mediates monoubiquitination of histone H2A 'Lys-119', rendering chromatin heritably changed in its expressibility.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Customer Reviews 
Loading...