C1orf124 (SPRTN) (AK027317) Human Untagged Clone

CAT#: SC312406

(untagged)-Human cDNA FLJ14411 fis, clone HEMBA1004507



CNY 9,120.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


SPRTN rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C1orf124; DVC1; PRO4323; spartan
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for AK027317, the custom clone sequence may differ by one or more nucleotides
ATGGATGATGACTTGATGTTGGCACTGCGGCTTCAGGAGGAGTGGAACTTGCAGGAGGCG
GAGCGCGATCATGCCCAGGAGTCCCTGTCGCTAGTGGACGCGTCGTGGGAGTTGGTGGAC
CCCACACCGGACTTGCAGGCACTGTTTGTTCAGTTTAACGACCAATTCTTCTGGGGCCAG
CTGGAGGCCGTCGAGGTGAAGTGGAGCGTGCGAATGACCCTGTGTGCTGGGATATGCAGC
TATGAAGGGAAGGGTGGAATGTGTTCCATCCGTCTCAGCGAACCCCTTTTGAAGTTGAGG
CCAAGAAAGGATCTTGTAGAGGTATACCATACTTTTCACGATGAGGTGGATGAGTATCGG
CGACACTGGTGGCGCTGCAATGGGCCGTGCCAGCACAGGCCACCGTATTACGGCTATGTC
AAACGAGCTACTAACAGGGAACCCTCTGCTCATGACTATTGGTGGGCTGAGCACCAGAAA
ACCTGTGGAGGCACTTACATAAAAATCAAGGAACCAGAGAATTACTCAAAAAAAAGGCAA
AGGAAAGGCAAAACTAGGAAAGGAACCAGTATTGGCCGCAGAGAA
Restriction Sites Please inquire     
ACCN AK027317
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq AK027317.1, BAB55037.1
RefSeq Size 1659 bp
RefSeq ORF 1659 bp
Locus ID 83932
Protein Families Druggable Genome
Gene Summary The protein encoded by this gene may play a role in DNA repair during replication of damaged DNA. This protein recruits valosin containing protein (p97) to stalled DNA replication forks where it may prevent excessive translesional DNA synthesis and limit the number of DNA-damage induced mutations. It may also be involved in replication-related G2/M-checkpoint regulation. Deficiency of a similar protein in mouse causes chromosomal instability and progeroid phenotypes. Mutations in this gene have been associated with Ruijs-Aalfs syndrome (RJALS). Alternatively spliced transcript variants have been identified. [provided by RefSeq, Mar 2015]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Customer Reviews 
Loading...