GALNT9 (NM_021808) Human Untagged Clone

CAT#: SC312588

GALNT9 (untagged)-Human UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9 (GalNAc-T9) (GALNT9), transcript variant B



  "NM_021808" in other vectors (6)

CNY 2,400.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-GALNT9 Antibody
    • 50 ug

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GALNAC-T9; GALNACT9
Vector PCMV6-Neo
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_021808 edited
AGGCCAACTTCAGCCTGGCACGGCGGCGCCGCGGACTCCACCATCCCGGGGAAGGAGCCG
GACCCCTGTGTGGCAGTGTGGCGGCAGCATGGAGGTGCTGCCCTGCTCCCGCGTGGCCCA
CATCGAGCGCACCAGGAAGCCCTACAACAACGACATTGACTACTACGCCAAGCGCAACGC
CCTGCGCGCCGCCGAGGTGTGGATGGATGACTTCAAGTCCCACGTGTACATGGCCTGGAA
CATCCCCATGTCGAACCCAGGGGTGGACTTCGGGGACGTGTCTGAGAGGCTGGCCCTGCG
TCAGAGGCTGAAGTGTCGCAGCTTCAAGTGGTACCTGGAGAACGTGTACCCGGAGATGAG
GGTCTACAACAACACCCTCACGTACGGAGAGGTGAGAAACAGCAAAGCCAGTGCCTACTG
TCTGGACCAGGGAGCGGAGGACGGCGACCGGGCGATCCTCTACCCCTGCCACGGGATGTC
CTCCCAGCTGGTGCGGTACAGCGCTGACGGCCTGCTGCAGCTGGGGCCTCTGGGCTCCAC
AGCCTTCTTGCCTGACTCCAAGTGTCTGGTGGATGACGGCACGGGCCGCATGCCCACCCT
GAAGAAGTGTGAGGATGTGGCGCGGCCAACACAGCGGCTGTGGGACTTCACCCAGAGTGG
CCCCATTGTGAGCCGGGCCACGGGCCGCTGCCTGGAGGTGGAGATGTCCAAAGATGCCAA
CTTTGGGCTCCGGCTGGTGGTACAGAGGTGCTCGGGGCAGAAGTGGATGATCAGAAACTG
GATCAAACACGCACGGCACTGACCCCACCTCCGCCCGGACCCCCACAGACCTCGGG
Restriction Sites Please inquire     
ACCN NM_021808
Insert Size 800 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_021808.2, NP_068580.2
RefSeq Size 1741 bp
RefSeq ORF 714 bp
Locus ID 50614
UniProt ID Q9HCQ5
Protein Families Transmembrane
Protein Pathways Metabolic pathways, O-Glycan biosynthesis
Gene Summary This gene encodes a member of the UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase (GalNAc-T) family of enzymes. GalNAc-Ts initiate mucin-type O-linked glycosylation in the Golgi apparatus by catalyzing the transfer of GalNAc to serine and threonine residues on target proteins. They are characterized by an N-terminal transmembrane domain, a stem region, a lumenal catalytic domain containing a GT1 motif and Gal/GalNAc transferase motif, and a C-terminal ricin/lectin-like domain. GalNAc-Ts have different, but overlapping, substrate specificities and patterns of expression. This gene is expressed specifically in the brain, with highest expression in the cerebellum. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (B) contains a distinct 5' UTR and lacks an in-frame portion of the 5' coding region, compared to variant A. The resulting isoform (B) has a shorter N-terminus compared to isoform A, and lacks the glycosyltransferase domain.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...