Adenylate kinase 5 (AK5) (AK090967) Human Untagged Clone

CAT#: SC312597

(untagged)-Human cDNA FLJ33648 fis, clone BRAMY2024449, weakly similar to ADENYLATE KINASE ISOENZYME 1 (EC 2.7.4.3)



CNY 9,120.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
AK5 mouse monoclonal antibody, clone OTI2F9 (formerly 2F9)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AK6
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for AK090967, the custom clone sequence may differ by one or more nucleotides
ATGAACACCAACGATGCCAAGGAGTATCTGGCCCGGAGGGAAATCCCTCAGCTTTTTGAG
AGCCTTTTGAATGGACTGATGTGTTCTAAGCCCGAAGATCCAGTAGAATACTTGGAAAGT
TGTTTACAAAAAGTAAAGGAACTGGGTGGCTGTGACAAGGTGAAATGGGATACATTTGTA
AGCCAGGAAAAGAAGACCTTACCCCCACTAAATGGAGGACAGTCACGGAGATCCTTTCTA
AGAAATGAAAGTGACACGGATCTCTCTGAGACTGCAGAGTTGATTGAGGAGTATGAGGTT
TTTGATCCTACCAGACCTCGACCAAAAATCATTCTTGTTATAGGTGGTCCAGGAAGTGGA
AAGGGTACTCAGAGTTTGAAAATTGCAGAACGATATGGATTCCAATACATTTCTGTGGGA
GAATTATTAAGAAAGAAGATCCACAGTACCAGCAGCAATAGGAAATGGAGTCTTATTGCC
AAGATAATTACAACTGGAGAATTGGCCCCACAGGAAACAACAATTACAGAGATAAAACAA
AAATTGATGCAAATACCTGATGAAGAGGGCATTGTTATTGATGGATTTCCAAGAGATGTT
GCCCAGGCTCTATCTTTTGAGGACCAATACAGCCTACGCCCTCAGACAAAGATGCCTGTG
CAGTCAGATCCTCTCCCTTACGCTGCTCCCTGCGGGGTATGTCCAGTCCGTCAAGATTCT
CCC
Restriction Sites Please inquire     
ACCN AK090967
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq AK090967.1, BAC03558.1
RefSeq Size 2148 bp
RefSeq ORF 2148 bp
Locus ID 26289
Domains ADK
Protein Families Druggable Genome
Protein Pathways Metabolic pathways, Purine metabolism
Gene Summary This gene encodes a member of the adenylate kinase family, which is involved in regulating the adenine nucleotide composition within a cell by catalyzing the reversible transfer of phosphate groups among adenine nucleotides. This member is related to the UMP/CMP kinase of several species. It is located in the cytosol and expressed exclusively in brain. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Customer Reviews 
Loading...