MARCH I (MARCH1) (AL713759) Human Untagged Clone

CAT#: SC312817

(untagged)-Human mRNA, cDNA DKFZp564M1682 (from clone DKFZp564M1682)



CNY 9,120.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-MARCH1 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms MARCH-I; RNF171
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for AL713759, the custom clone sequence may differ by one or more nucleotides
ATGCTGGGCTGGTGTGAAGCGATAGCCCGTAACCCTCACAGAATTCCAAACAACACGCGA
ACACCCGAGATCTCAGGGGATTTGGCTGACGCCTCACAAACCTCCACATTGAATGAAAAA
TCCCCAGGGCGATCTGCAAGTCGATCAAGTAACATTTCAAAAGCAAGCAGCCCAACAACA
GGGACAGCTCCCAGGAGCCAGTCAAGGTTGTCTGTCTGTCCATCCACTCAGGACATCTGC
AGAATCTGTCACTGCGAAGGGGATGAAGAGAGCCCCCTCATCACACCCTGTCGCTGCACT
GGGACACTGCGCTTTGTCCACCAGTCCTGCCTCCACCAGTGGATAAAGAGCTCAGATACA
CGCTGCTGTGAGCTCTGCAAGTATGACTTCATAATGGAGACCAAGCTCAAACCCCTCCGG
AAGTGGGAGAAACTACAGATGACCACAAGTGAAAGGAGGAAAATATTCTGCTCTGTCACA
TTCCACGTAATCGCGATCACCTGTGTGGTTTGGTCTTTGTATGTATTGATAGACCGGACA
GCGGAGGAAATCAAGCAAGGCAATGACAATGGTGTCCTTGAATGGCCATTTTGGACAAAA
CTGGTTGTGGTAGCCATTGGCTTCACAGGAGGTCTTGTCTTCATGTACGTACAGTGTAAA
GTCTATGTTCAGTTGTGGCGCAGGCTGAAGGCCTACAACCGTGTGATCTTTGTACAAAAT
TGCCCAGACACTGCCAAAAAACTGGAGAAGAACTTCTCATGTAATGTAAACACAGACATC
AAAGATGCTGTGGTAGTGCCTGTACCACAAACAGGTGCAAATTCACTGCCATCTGCAGAG
GGTGGCCCCCCTGAAGTTGTATCAGTC
Restriction Sites Please inquire     
ACCN AL713759
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq AL713759.1, CAD28529.1
RefSeq Size 2715 bp
RefSeq ORF 2715 bp
Locus ID 55016
Domains RING
Protein Families Druggable Genome, Transmembrane
Gene Summary MARCH1 is a member of the MARCH family of membrane-bound E3 ubiquitin ligases (EC 6.3.2.19). MARCH proteins add ubiquitin (see MIM 191339) to target lysines in substrate proteins, thereby signaling their vesicular transport between membrane compartments. MARCH1 downregulates the surface expression of major histocompatibility complex (MHC) class II molecules (see MIM 142880) and other glycoproteins by directing them to the late endosomal/lysosomal compartment (Bartee et al., 2004 [PubMed 14722266]; Thibodeau et al., 2008 [PubMed 18389477]; De Gassart et al., 2008 [PubMed 18305173]).[supplied by OMIM, Mar 2010]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Customer Reviews 
Loading...