MEIS2 (NM_172316) Human Untagged Clone
CAT#: SC312879
MEIS2 (untagged)-Human Meis homeobox 2 (MEIS2), transcript variant h
CNY 6,270.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CPCMR; HsT18361; MRG1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_172316, the custom clone sequence may differ by one or more nucleotides
ATGGCTCTGGTCTTTGAGAAGTGCGAGCTGGCGACCTGCACTCCCCGGGAACCTGGAGTG GCTGGCGGAGACGTCTGCTCCTCCGACTCCTTCAACGAGGACATCGCGGTCTTCGCCAAG CAGGTTCGCGCCGAAAAGCCACTTTTTTCCTCAAATCCAGAGCTGGACAATTTGATGATA CAAGCAATACAAGTACTAAGGTTTCATCTTTTGGAGTTAGAAAAGGTCCACGAACTGTGC GATAACTTCTGCCACCGATACATTAGCTGTTTGAAGGGGAAAATGCCCATCGACCTCGTC ATTGATGAAAGAGACGGCAGCTCCAAGTCAGATCATGAAGAACTTTCAGGCTCCTCCACA AATCTCGCTGACCATAACCCTTCTTCTTGGCGAGACCACGATGATGCAACCTCAACCCAC TCAGCAGGCACCCCAGGGCCCTCCAGTGGGGGCCATGCTTCCCAGAGCGGAGACAACAGC AGTGAGCAAGGGGATGGTTTAGACAACAGTGTAGCTTCACCTGGTACAGGTGACGATGAT GATCCGGATAAGGACAAAAAACGCCAGAAGAAAAGAGGCATTTTCCCCAAAGTAGCAACA AATATCATGAGAGCATGGCTCTTCCAGCATCTCACACATCCGTACCCTTCCGAAGAGCAG AAGAAACAGTTAGCGCAAGACACAGGACTTACAATTCTCCAAGTAAACAACTGGTTTATT AATGCCAGAAGAAGAATAGTACAGCCCATGATTGACCAGTCAAATCGAGCAGTGAGCCAA GGAGCAGCATATAGTCCAGAGGGTCAGCCCATGGGGAGCTTTGTGTTGGATGGTCAGCAA CACATGGGGATCCGGCCTGCAGGACCTATGAGTGGAATGGGCATGAATATGGGCATGGAT GGGCAATGGCACTACATG |
Restriction Sites | Please inquire |
ACCN | NM_172316 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_172316.1, NP_758527.1 |
RefSeq Size | 3175 bp |
RefSeq ORF | 921 bp |
Locus ID | 4212 |
UniProt ID | O14770 |
Protein Families | Transcription Factors |
Gene Summary | This gene encodes a homeobox protein belonging to the TALE ('three amino acid loop extension') family of homeodomain-containing proteins. TALE homeobox proteins are highly conserved transcription regulators, and several members have been shown to be essential contributors to developmental programs. Multiple transcript variants encoding distinct isoforms have been described for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (h) differs in the 5' UTR and coding sequence compared to isoform a. The resulting isoform (h) has a shorter and distinct N-terminus and lacks an alternate internal segment compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222497 | MEIS2 (Myc-DDK-tagged)-Human Meis homeobox 2 (MEIS2), transcript variant h |
CNY 2,400.00 |
|
RC222497L3 | Lenti-ORF clone of MEIS2 (Myc-DDK-tagged)-Human Meis homeobox 2 (MEIS2), transcript variant h |
CNY 5,890.00 |
|
RC222497L4 | Lenti-ORF clone of MEIS2 (mGFP-tagged)-Human Meis homeobox 2 (MEIS2), transcript variant h |
CNY 5,890.00 |
|
RG222497 | MEIS2 (tGFP-tagged) - Human Meis homeobox 2 (MEIS2), transcript variant h |
CNY 4,370.00 |