C18orf1 (LDLRAD4) (NM_181481) Human Untagged Clone
CAT#: SC312881
LDLRAD4 (untagged)-Human chromosome 18 open reading frame 1 (C18orf1), transcript variant a1
CNY 6,270.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C18orf1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC312881 representing NM_181481.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCCGGAAGCTGGTTTTCAGGCCACAAATGCTTTCACAGAGTGCAAATTCACCTGCACCAGTGGTAAA TGCTTGTATCTTGGTTCGCTGGTCTGTAACCAACAGAACGACTGTGGGGACAACAGTGACGAAGAGAAC TGTCTCCTGGTGACCGAGCACCCGCCTCCGGGCATCTTCAACTCGGAGCTGGAGTTCGCCCAAATCATC ATCATCGTCGTGGTGGTCACGGTGATGGTGGTGGTCATCGTCTGCCTGCTGAACCACTACAAAGTCTCC ACGCGGTCCTTCATCAACCGCCCGAACCAGAGCCGGAGGCGGGAGGACGGGCTGCCGCAGGAAGGGTGC CTGTGGCCTTCAGACAGCGCCGCACCGCGGCTGGGCGCCTCGGAGATCATGCATGCCCCGCGGTCCAGG GACAGGTTCACAGCGCCGTCCTTCATCCAGAGGGATCGCTTCAGCCGCTTCCAGCCCACCTACCCCTAT GTGCAGCACGAGATTGATCTTCCTCCCACCATCTCCCTGTCCGACGGTGAAGAGCCACCTCCTTACCAG GGGCCCTGCACCCTGCAGCTCCGGGACCCTGAACAGCAGATGGAACTCAACCGAGAGTCCGTGAGGGCC CCACCCAACCGAACCATATTTGACAGTGATTTAATAGACATTGCTATGTATAGCGGGGGTCCATGCCCA CCCAGCAGCAACTCGGGCATCAGTGCAAGCACCTGCAGCAGTAACGGGAGGATGGAGGGGCCACCCCCC ACATACAGCGAGGTGATGGGCCACCACCCAGGCGCCTCTTTCCTCCATCACCAGCGCAGCAACGCACAC AGGGGCAGCAGACTGCAGTTTCAGCAGAACAATGCAGAGAGCACAATAGTACCCATCAAAGGCAAAGAT AGGAAGCCTGGGAACCTGGTCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_181481 |
Insert Size | 921 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_181481.4 |
RefSeq Size | 8484 bp |
RefSeq ORF | 921 bp |
Locus ID | 753 |
UniProt ID | O15165 |
Protein Families | Druggable Genome, Transmembrane |
MW | 33.9 kDa |
Gene Summary | Functions as a negative regulator of TGF-beta signaling and thereby probably plays a role in cell proliferation, differentiation, apoptosis, motility, extracellular matrix production and immunosuppression. In the canonical TGF-beta pathway, ZFYVE9/SARA recruits the intracellular signal transducer and transcriptional modulators SMAD2 and SMAD3 to the TGF-beta receptor. Phosphorylated by the receptor, SMAD2 and SMAD3 then form a heteromeric complex with SMAD4 that translocates to the nucleus to regulate transcription. Through interaction with SMAD2 and SMAD3, LDLRAD4 may compete with ZFYVE9 and SMAD4 and prevent propagation of the intracellular signal.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (a1) encodes the longest isoform (alpha 1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222441 | LDLRAD4 (Myc-DDK-tagged)-Human chromosome 18 open reading frame 1 (C18orf1), transcript variant a1 |
CNY 3,600.00 |
|
RC222441L1 | Lenti ORF clone of Human chromosome 18 open reading frame 1 (C18orf1), transcript variant a1, Myc-DDK-tagged |
CNY 6,000.00 |
|
RC222441L2 | Lenti ORF clone of Human chromosome 18 open reading frame 1 (C18orf1), transcript variant a1, mGFP tagged |
CNY 5,890.00 |
|
RC222441L3 | Lenti ORF clone of Human chromosome 18 open reading frame 1 (C18orf1), transcript variant a1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC222441L4 | Lenti ORF clone of Human chromosome 18 open reading frame 1 (C18orf1), transcript variant a1, mGFP tagged |
CNY 5,890.00 |
|
RG222441 | LDLRAD4 (tGFP-tagged) - Human chromosome 18 open reading frame 1 (C18orf1), transcript variant a1 |
CNY 5,200.00 |
其它C18orf1产品