United States
Germany
Japan
United Kingdom
China
MDFIC (NM_199072) Human Untagged Clone
CAT＃: SC313109
MDFIC (untagged)-Human MyoD family inhibitor domain containing (MDFIC), transcript variant 1
CNY 4,024.00
CNY 5,700.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | HIC; MDFIC1 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_199072, the custom clone sequence may differ by one or more nucleotides
GTGCGCGGAGTCAGAGCCGCCACCGCTGCCGCAGTTGCCGCCACTGCGGCGTCTGGGCTGAGCCGGAGGG AGGCGGGAGGACGCGCAGGGGCGGCCGCCGCCGTCGTCAGGCCACCGGGGCGAAAATGCGGCCGCTGCCG GAGGCTCGCTAACTTTCCGGGGCGGAAGAGGAGGAGGAGGAGGAGGAAGGGGCTTGGAGCGACTACGGGG GGATGCGGAGAAGCAGTCAGTTCCCTGCACCCAGCACCTCACAGCCCTTCCTCCGTGCGCCCTGCCGGGC GGCGAGCTAGGCGGCAGCGGCGCGGCGCGGGCTCGGCGGAGCGGCCCATGTCCGGCGCGGGCGAAGCCCT CGCTCCCGGGCCCGTGGGGCCGCAGCGCGTGGCCGAGGCGGGCGGCGGCCAGCTGGGCTCCACAGCCCAG GGAAAATGTGATAAAGACAATACTGAGAAAGATATAACTCAAGCTACCAATAGCCACTTCACACATGGAG AGATGCAAGACCAGTCCATTTGGGGAAATCCTTCGGATGGTGAACTCATTAGAACCCAACCTCAGCGCTT GCCTCAGCTTCAGACTTCAGCCCAGGTGCCAAGTGGTGAGGAAATAGGCAAGATAAAGAACGGCCACACA GGTCTGAGCAATGGAAATGGAATTCACCACGGGGCCAAACACGGATCCGCAGATAATCGCAAACTTTCAG CACCTGTTTCTCAAAAAATGCATAGAAAAATTCAGTCCAGCTTGTCTGTAAACAGCGATATCAGTAAGAA GAGCAAAGTAAATGCTGTCTTTTCCCAAAAGACAGGCTCTTCACCTGAAGATTGTTGTGTCCACTGTATC CTGGCTTGCTTGTTCTGCGAATTCCTGACCCTTTGCAACATTGTCCTGGGACAAGCGTCATGTGGCATCT GCACCTCAGAAGCCTGCTGCTGTTGCTGTGGTGACGAGATGGGGGATGATTGTAACTGCCCTTGTGATAT GGACTGTGGCATCATGGATGCCTGTTGTGAATCATCAGACTGCTTGGAAATCTGTATGGAATGCTGTGGA ATTTGTTTTCCTTCATAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_199072 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_199072.4, NP_951038.1 |
| RefSeq Size | 5312 bp |
| RefSeq ORF | 1068 bp |
| Locus ID | 29969 |
| UniProt ID | Q9P1T7 |
| Gene Summary | This gene product is a member of a family of proteins characterized by a specific cysteine-rich C-terminal domain, which is involved in transcriptional regulation of viral genome expression. Alternative translation initiation from an upstream non-AUG (GUG), and an in-frame, downstream AUG codon, results in the production of two isoforms, p40 and p32, respectively, which have different subcellular localization; p32 is mainly found in the cytoplasm, whereas p40 is targeted to the nucleolus. Both isoforms have transcriptional regulatory activity that is attributable to the cysteine-rich C-terminal domain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009] Transcript Variant: This variant (1) represents the longer transcript. It encodes the longest isoform (p40) via the use of an upstream non-AUG (GUG) translation initiation codon. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CCDS Note: This CCDS ID represents the longest MDFIC isoform, known as p40, as described in PMIDs 11139147 and 10671520. This isoform initiates translation at a non-AUG (GUG) start codon that is well-conserved. Alternative translation initiation at a downstream AUG start codon produces an isoform that is 109 aa shorter at the N-terminus, known as p32. These isoforms exhibit distinct subcellular distributions, as indicated in PMID:10671520. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC211395 | MDFIC (Myc-DDK-tagged)-Human MyoD family inhibitor domain containing (MDFIC), transcript variant 1 |
CNY 3,656.00 |
|
| RC211395L3 | Lenti ORF clone of Human MyoD family inhibitor domain containing (MDFIC), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC211395L4 | Lenti ORF clone of Human MyoD family inhibitor domain containing (MDFIC), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RG211395 | MDFIC (tGFP-tagged) - Human MyoD family inhibitor domain containing (MDFIC), transcript variant 1 |
CNY 5,256.00 |
