PIP5K3 (PIKFYVE) (NM_152671) Human Untagged Clone

CAT#: SC313536

PIKFYVE (untagged)-Human phosphoinositide kinase, FYVE finger containing (PIKFYVE), transcript variant 3



  "NM_152671" in other vectors (4)

CNY 7,220.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
PIKFYVE mouse monoclonal antibody,clone OTI1D2
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CFD; FAB1; HEL37; PIP5K; PIP5K3; ZFYVE29
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC313536 representing NM_152671.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCACAGATGATAAGACGTCCCCAACACTGGACTCTGCTAATGATTTGCCTCGATCTCCTACTAGT
CCTTCTCATCTCACACACTTTAAACCTTTGACTCCTGATCAAGATGAGCCCCCTTTTAAATCAGCTTAT
AGTTCTTTTGTAAATCTCTTTCGTTTTAACAAAGAGAGAGCAGAAGGAGGCCAGGGAGAACAGCAGCCT
TTGAGTGGAAGTTGGACCAGCCCTCAGCTCCCTTCGAGGACACAGTCTGTTAGGTCACCCACACCTTAT
AAAAAGCAGCTTAATGAGGAACTCCAGCGGCGCTCTTCAGCATTAGGAGACCTCCGAGCTTGCACATAT
TGTAGAAAAATAGCCTTAAGTTATGCTCATTCCACAGACAGTAATTCTATTGGGGAAGACTTGAATGCT
CTTTCAGATTCTGCTTGCTCTGTGTCTGTGCTTGATCCAAGTGAACCCCGAACACCTGTTGGGAGTAGG
AAAGCCAGCCGTAACATATTTTTAGAGGATGATTTGGCCTGGCAAAGTTTGATTCATCCAGATTCCTCA
AATACTCCTCTTTCAACAAGACTTGTATCTGTGCAAGAGGATGCTGGGAAATCTCCTGCTCGAAATAGA
TCAGCCAGCATTACTAACCTGTCACTGGATAGATCTGGTTCTCCTATGGTACCTTCATATGAGACATCT
GTCAGTCCCCAGGCTAACCGAACATATGTTAGGACAGAGACCACTGAGGATGAACGCAAAATTCTTCTG
GACAGTGTGCAGTTAAAAGACCTGTGGAAAAAAATCTGCCATCACAGCAGTGGAATGGAGTTTCAGGAT
CACCGCTACTGGTTGAGAACGCATCCCAACTGCATTGTAGGAAAGGAATTAGTCAACTGGCTAATCCGA
AATGGGCATATTGCCACAAGGGCACAAGCTATAGCAATTGGACAAGCAATGGTTGATGGACGTTGGCTG
GATTGTGTTAGTCATCACGACCAGCTTTTCAGAGATGAGTATGCGCTGTATAGACCACTGCAGAGTACA
GAATTTTCTGAGACGCCTTCTCCCGACAGTGACTCAGTGAACTCCGTGGAAGGACACTCTGAGCCATCC
TGGTTTAAAGACATAAAGTTTGATGACAGTGACACAGAACAGATAGCTGAAGAAGGTGACGATAATTTG
GCTAATTCTGCCAGTCCTAGCAAGCGCACATCAGTCAGCAGTTTCCAGTCCACAGTGGACAGTGACTCA
GCCGCTTCTATCAGCCTGAACGTGGAGCTGGACAACGTGAACTTCCATATCAAGAAGCCCTCCAAGTAC
CCACATGTGCCCCCTCACCCTGCTGACCAAAAAGGTAGGAGGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_152671
Insert Size 1356 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_152671.3
RefSeq Size 2130 bp
RefSeq ORF 1356 bp
Locus ID 200576
UniProt ID Q9Y2I7
Domains DEP
Protein Families Druggable Genome
Protein Pathways Endocytosis, Fc gamma R-mediated phagocytosis, Inositol phosphate metabolism, Metabolic pathways, Phosphatidylinositol signaling system, Regulation of actin cytoskeleton
MW 50.2 kDa
Gene Summary Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
Transcript Variant: This variant (3) lacks two in-frame exons in the 5' coding region and all of the 3' coding region and UTR, compared to variant 2. The encoded protein (isoform 3) has a shorter N-terminus and a short novel C-terminus, compared to isoform 2.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...