NUDT6 (NM_007083) Human Untagged Clone

CAT#: SC315525

NUDT6 (untagged)-Human nudix (nucleoside diphosphate linked moiety X)-type motif 6 (NUDT6), transcript variant 1



  "NM_007083" in other vectors (6)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
NUDT6 mouse monoclonal antibody, clone OTI9D12 (formerly 9D12)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ASFGF2; FGF-AS; FGF2AS; GFG-1; GFG1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC315525 representing NM_007083.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCGGCAGCCACTGAGCTGGGGCCGCTGGCGCGCGATGCTTGCCCGAACCTACGGCCCCGGGCCTTCG
GCGGGTTACCGCTGGGCCTCGGGCGCACAGGGTTACGTGCGGAATCCGCCAGTTGGAGCGTGCGATCTG
CAGGGCGAGCTGGACAGATTCGGGGGCATCTCGGTGCGCCTGGCGCGGCTCGATGCGCTGGACCGCCTG
GACGCTGCCGCCTTCCAGAAGGGCTTGCAGGCTGCAGTACAGCAATGGCGATCAGAAGGTAGAACAGCT
GTATGGCTGCACATTCCCATCCTCCAAAGCCGATTTATTGCCCCTGCTGCTTCCCTGGGCTTCTGCTTT
CACCACGCAGAATCGGATTCATCAACGTTGACTCTGTGGCTGAGAGAAGGGCCCAGCAGATTACCAGGA
TATGCTTCACATCAAGTAGGAGTTGCAGGAGCTGTATTTGATGAAAGTACTAGAAAAATACTGGTTGTA
CAAGATCGAAATAAATTGAAAAATATGTGGAAGTTTCCAGGAGGCCTGTCAGAGCCTGAAGAAGATATT
GGAGACACAGCGGTTCGAGAAGTTTTTGAAGAGACTGGTATAAAATCAGAATTCAGGTCCGTCCTGAGT
ATTCGGCAACAGCACACAAATCCTGGAGCTTTTGGGAAGTCAGATATGTATATCATCTGCCGCCTAAAG
CCATATTCATTCACCATAAATTTTTGCCAGGAAGAATGCTTAAGATGTGAGTGGATGGATCTCAATGAC
CTGGCGAAGACTGAAAATACAACTCCCATCACCAGCAGAGTTGCTAGGCTGCTGCTGTATGGGTACAGA
GAAGGGTTTGACAAAATTGACCTGACTGTGGAAGAACTTCCAGCAGTTTACACAGGACTGTTTTATAAA
CTCTATCATAAGGAACTGCCAGAGAATTATAAAACTATGAAAGGAATTGATTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_007083
Insert Size 951 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_007083.4
RefSeq Size 1197 bp
RefSeq ORF 951 bp
Locus ID 11162
UniProt ID P53370
Domains NUDIX
MW 35.7 kDa
Gene Summary This gene overlaps and lies on the opposite strand from FGF2 gene, and is thought to be the FGF2 antisense gene. The two genes are independently transcribed, and their expression shows an inverse relationship, suggesting that this antisense transcript may regulate FGF2 expression. This gene has also been shown to have hormone-regulatory and antiproliferative actions in the pituitary that are independent of FGF2 expression. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...