GPBAR1 (NM_001077194) Human Untagged Clone
CAT#: SC315529
GPBAR1 (untagged)-Human G protein-coupled bile acid receptor 1 (GPBAR1), transcript variant 2
CNY 6,270.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BG37; GPCR19; GPR131; M-BAR; TGR5 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001077194, the custom clone sequence may differ by one or more nucleotides
ATGACGCCCAACAGCACTGGCGAGGTGCCCAGCCCCATTCCCAAGGGGGCTTTGGGGCTCTCCCTGGCCC TGGCAAGCCTCATCATCACCGCGAACCTGCTCCTAGCCCTGGGCATCGCCTGGGACCGCCGCCTGCGCAG CCCACCTGCTGGCTGCTTCTTCCTGAGCCTACTGCTGGCTGGGCTGCTCACGGGTCTGGCATTGCCCACA TTGCCAGGGCTGTGGAACCAGAGTCGCCGGGGTTACTGGTCCTGCCTCCTCGTCTACTTGGCTCCCAACT TCTCCTTCCTCTCCCTGCTTGCCAACCTCTTGCTGGTGCACGGGGAGCGCTACATGGCAGTCCTGAGGCC ACTCCAGCCCCCTGGGAGCATTCGGCTGGCCCTGCTCCTCACCTGGGCTGGTCCCCTGCTCTTTGCCAGT CTGCCCGCTCTGGGGTGGAACCACTGGACCCCTGGTGCCAACTGCAGCTCCCAGGCTATCTTCCCAGCCC CCTACCTGTACCTCGAAGTCTATGGGCTCCTGCTGCCCGCCGTGGGTGCTGCTGCCTTCCTCTCTGTCCG CGTGCTGGCCACTGCCCACCGCCAGCTGCAGGACATCTGCCGGCTGGAGCGGGCAGTGTGCCGCGATGAG CCCTCCGCCCTGGCCCGGGCCCTTACCTGGAGGCAGGCAAGGGCACAGGCTGGAGCCATGCTGCTCTTCG GGCTGTGCTGGGGGCCCTACGTGGCCACACTGCTCCTCTCAGTCCTGGCCTATGAGCAGCGCCCGCCACT GGGGCCTGGGACACTGTTGTCCCTCCTCTCCCTAGGAAGTGCCAGTGCAGCGGCAGTGCCCGTAGCCATG GGGCTGGGCGATCAGCGCTACACAGCCCCCTGGAGGGCAGCCGCCCAAAGGTGCCTGCAGGGGCTGTGGG GAAGAGCCTCCCGGGACAGTCCCGGCCCCAGCATTGCCTACCACCCAAGCAGCCAAAGCAGTGTCGACCT GGACTTGAACTAA |
Restriction Sites | ECoRI-NOT |
ACCN | NM_001077194 |
Insert Size | 1400 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001077194.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001077194.1, NP_001070662.1 |
RefSeq Size | 1515 bp |
RefSeq ORF | 993 bp |
Locus ID | 151306 |
UniProt ID | Q8TDU6 |
Protein Families | Druggable Genome |
Gene Summary | This gene encodes a member of the G protein-coupled receptor (GPCR) superfamily. This enzyme functions as a cell surface receptor for bile acids. Treatment of cells expressing this GPCR with bile acids induces the production of intracellular cAMP, activation of a MAP kinase signaling pathway, and internalization of the receptor. The receptor is implicated in the suppression of macrophage functions and regulation of energy homeostasis by bile acids. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1, 2, and 3 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC224769 | GPBAR1 (Myc-DDK-tagged)-Human G protein-coupled bile acid receptor 1 (GPBAR1), transcript variant 2 |
CNY 2,400.00 |
|
RC224769L3 | Lenti ORF clone of Human G protein-coupled bile acid receptor 1 (GPBAR1), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC224769L4 | Lenti ORF clone of Human G protein-coupled bile acid receptor 1 (GPBAR1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG224769 | GPBAR1 (tGFP-tagged) - Human G protein-coupled bile acid receptor 1 (GPBAR1), transcript variant 2 |
CNY 4,000.00 |