PPP1R1C (NM_001080545) Human Untagged Clone
CAT#: SC315666
PPP1R1C (untagged)-Human protein phosphatase 1, regulatory (inhibitor) subunit 1C (PPP1R1C)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | IPP5 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC315666 representing NM_001080545.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGAGCCCAACAGTCCCAAAAAGATACAGTTTGCCGTGCCTGTATTCCAGAGTCAGATTGCACCTGAA GCAGCAGAGCAGATCAGGAAAAGAAGACCTACACCAGCATCACTTGTGATTCTCAATGAGCATAACCCC CCAGAAATAGATGACAAGAGGGGGCCCAACACACAAGGGGAATTACAGAATGCATCCCCTAAGCAAAGG AAGCAGAGTGTGTACACACCACCCACCATAAAAGGGGTTAAGCATCTGAAAGGCCAGAATGAATCAGCA TTCCCTGAAGAAGAAGAAGGCACCAATGAAAGAGAGGAGCAGCGGGACCATTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001080545 |
Insert Size | 330 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001080545.2 |
RefSeq Size | 1078 bp |
RefSeq ORF | 330 bp |
Locus ID | 151242 |
UniProt ID | Q8WVI7 |
Protein Families | Druggable Genome, Phosphatase |
MW | 12.3 kDa |
Gene Summary | Protein phosphatase-1 (PP1) is a major serine/threonine phosphatase that regulates a variety of cellular functions. PP1 consists of a catalytic subunit (see PPP1CA; MIM 176875) and regulatory subunits that determine the subcellular localization of PP1 or regulate its function. PPP1R1C belongs to a group of PP1 inhibitory subunits that are themselves regulated by phosphorylation (Wang et al., 2008 [PubMed 18310074]).[supplied by OMIM, Feb 2010] Transcript Variant: This variant (3) uses an alternate in-frame splice site in the 5' coding region and differs in the 3' UTR compared to variant 1. The resulting protein is shorter compared to isoform 1. Variants 2 and 3 encode the same protein (isoform 2). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC205047 | PPP1R1C (Myc-DDK-tagged)-Human protein phosphatase 1, regulatory (inhibitor) subunit 1C (PPP1R1C) |
CNY 1,200.00 |
|
RC205047L3 | Lenti ORF clone of Human protein phosphatase 1, regulatory (inhibitor) subunit 1C (PPP1R1C), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC205047L4 | Lenti ORF clone of Human protein phosphatase 1, regulatory (inhibitor) subunit 1C (PPP1R1C), mGFP tagged |
CNY 5,890.00 |
|
RG205047 | PPP1R1C (tGFP-tagged) - Human protein phosphatase 1, regulatory (inhibitor) subunit 1C (PPP1R1C) |
CNY 2,800.00 |
其它PPP1R1C产品