Caspase 8 (CASP8) (NM_001080125) Human Untagged Clone
CAT#: SC315793
CASP8 (untagged)-Human caspase 8, apoptosis-related cysteine peptidase (CASP8), transcript variant G
CNY 4,016.00
CNY 8,650.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ALPS2B; CAP4; Casp-8; FLICE; MACH; MCH5 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_001080125 edited
ATGGAGGGAGGCAGAAGAGCCAGGGTGGTTATTGAAAGTAAAAGAAACTTCTTCCTGGGA GCCTTTCCCACCCCCTTCCCTGCTGAGCACGTGGAGTTAGGCAGGTTAGGGGACTCGGAG ACTGCGATGGTGCCAGGAAAGGGTGGAGCGGATTATATTCTCCTGCCTTTTAAAAAGATG GACTTCAGCAGAAATCTTTATGATATTGGGGAACAACTGGACAGTGAAGATCTGGCCTCC CTCAAGTTCCTGAGCCTGGACTACATTCCGCAAAGGAAGCAAGAACCCATCAAGGATGCC TTGATGTTATTCCAGAGACTCCAGGAAAAGAGAATGTTGGAGGAAAGCAATCTGTCCTTC CTGAAGGAGCTGCTCTTCCGAATTAATAGACTGGATTTGCTGATTACCTACCTAAACACT AGAAAGGAGGAGATGGAAAGGGAACTTCAGACACCAGGCAGGGCTCAAATTTCTGCCTAC AGGGTCATGCTCTATCAGATTTCAGAAGAAGTGAGCAGATCAGAATTGAGGTCTTTTAAG TTTCTTTTGCAAGAGGAAATCTCCAAATGCAAACTGGATGATGACATGAACCTGCTGGAT ATTTTCATAGAGATGGAGAAGAGGGTCATCCTGGGAGAAGGAAAGTTGGACATCCTGAAA AGAGTCTGTGCCCAAATCAACAAGAGCCTGCTGAAGATAATCAACGACTATGAAGAATTC AGCAAAGAGAGAAGCAGCAGCCTTGAAGGAAGTCCTGATGAATTTTCAAATGGGGAGGAG TTGTGTGGGGTAATGACAATCTCGGACTCTCCAAGAGAACAGGATAGTGAATCACAGACT TTGGACAAAGTTTACCAAATGAAAAGCAAACCTCGGGGATACTGTCTGATCATCAACAAT CACAATTTTGCAAAAGCACGGGAGAAAGTGCCCAAACTTCACAGCATTAGGGACAGGAAT GGAACACACTTGGATGCAGGGGCTTTGACCACGACCTTTGAAGAGCTTCATTTTGAGATC AAGCCCCACGATGACTGCACAGTAGAGCAAATCTATGAGATTTTGAAAATCTACCAACTC ATGGACCACAGTAACATGGACTGCTTCATCTGCTGTATCCTCTCCCATGGAGACAAGGGC ATCATCTATGGCACTGATGGACAGGAGGCCCCCATCTATGAGCTGACATCTCAGTTCACT GGTTTGAAGTGCCCTTCCCTTGCTGGAAAACCCAAAGTGTTTTTTATTCAGGCTTGTCAG GGGGATAACTACCAGAAAGGTATACCTGTTGAGACTGATTCAGAGGAGCAACCCTATTTA GAAATGGATTTATCATCACCTCAAACGAGATATATCCCGGATGAGGCTGACTTTCTGCTG GGGATGGCCACTGTGAATAACTGTGTTTCCTACCGAAACCCTGCAGAGGGAACCTGGTAC ATCCAGTCACTTTGCCAGAGCCTGAGAGAGCGATGTCCTCGAGGCGATGATATTCTCACC ATCCTGACTGAAGTGAACTATGAAGTAAGCAACAAGGATGACAAGAAAAACATGGGGAAA CAGATGCCTCAGCCTACTTTCACACTAAGAAAAAAACTTGTCTTCCCTTCTGATTGA |
Restriction Sites | Please inquire |
ACCN | NM_001080125 |
Insert Size | 1600 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001080125.1, NP_001073594.1 |
RefSeq Size | 2938 bp |
RefSeq ORF | 1617 bp |
Locus ID | 841 |
UniProt ID | Q14790 |
Protein Families | Druggable Genome, Protease |
Protein Pathways | Alzheimer's disease, Apoptosis, Huntington's disease, NOD-like receptor signaling pathway, p53 signaling pathway, Pathways in cancer, RIG-I-like receptor signaling pathway, Toll-like receptor signaling pathway, Viral myocarditis |
Gene Summary | This gene encodes a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes composed of a prodomain, a large protease subunit, and a small protease subunit. Activation of caspases requires proteolytic processing at conserved internal aspartic residues to generate a heterodimeric enzyme consisting of the large and small subunits. This protein is involved in the programmed cell death induced by Fas and various apoptotic stimuli. The N-terminal FADD-like death effector domain of this protein suggests that it may interact with Fas-interacting protein FADD. This protein was detected in the insoluble fraction of the affected brain region from Huntington disease patients but not in those from normal controls, which implicated the role in neurodegenerative diseases. Many alternatively spliced transcript variants encoding different isoforms have been described, although not all variants have had their full-length sequences determined. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (G), also known as procaspase-8L or 8L, encodes the longest protein (isoform G). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216300 | CASP8 (Myc-DDK-tagged)-Human caspase 8, apoptosis-related cysteine peptidase (CASP8), transcript variant G |
CNY 4,008.00 |
|
RC216300L1 | Lenti ORF clone of Human caspase 8, apoptosis-related cysteine peptidase (CASP8), transcript variant G, Myc-DDK-tagged |
CNY 6,408.00 |
|
RC216300L2 | Lenti ORF clone of Human caspase 8, apoptosis-related cysteine peptidase (CASP8), transcript variant G, mGFP tagged |
CNY 6,650.00 |
|
RC216300L3 | Lenti ORF clone of Human caspase 8, apoptosis-related cysteine peptidase (CASP8), transcript variant G, Myc-DDK-tagged |
CNY 6,650.00 |
|
RC216300L4 | Lenti ORF clone of Human caspase 8, apoptosis-related cysteine peptidase (CASP8), transcript variant G, mGFP tagged |
CNY 6,650.00 |
|
RG216300 | CASP8 (tGFP-tagged) - Human caspase 8, apoptosis-related cysteine peptidase (CASP8), transcript variant G |
CNY 5,230.00 |
其它Caspase 8产品