United States
Germany
Japan
United Kingdom
China
CD33 (NM_001082618) Human Untagged Clone
CAT＃: SC315982
CD33 (untagged)-Human CD33 molecule (CD33), transcript variant 2
CNY 3,600.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | p67; SIGLEC-3; SIGLEC3 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_001082618 edited
CAGACATGCCGCTGCTGCTACTGCTGCCCCTGCTGTGGGCAGACTTGACCCACAGGCCCA AAATCCTCATCCCTGGCACTCTAGAACCCGGCCACTCCAAAAACCTGACCTGCTCTGTGT CCTGGGCCTGTGAGCAGGGAACACCCCCGATCTTCTCCTGGTTGTCAGCTGCCCCCACCT CCCTGGGCCCCAGGACTACTCACTCCTCGGTGCTCATAATCACCCCACGGCCCCAGGACC ACGGCACCAACCTGACCTGTCAGGTGAAGTTCGCTGGAGCTGGTGTGACTACGGAGAGAA CCATCCAGCTCAACGTCACCTATGTTCCACAGAACCCAACAACTGGTATCTTTCCAGGAG ATGGCTCAGGGAAACAAGAGACCAGAGCAGGAGTGGTTCATGGGGCCATTGGAGGAGCTG GTGTTACAGCCCTGCTCGCTCTTTGTCTCTGCCTCATCTTCTTCATAGTGAAGACCCACA GGAGGAAAGCAGCCAGGACAGCAGTGGGCAGGAATGACACCCACCCTACCACAGGGTCAG CCTCCCCGAAACACCAGAAGAAGTCCAAGTTACATGGCCCCACTGAAACCTCAAGCTGTT CAGGTGCCGCCCCTACTGTGGAGATGGATGAGGAGCTGCATTATGCTTCCCTCAACTTTC ATGGGATGAATCCTTCCAAGGACACCTCCACCGAATACTCAGAGGTCAGGACCCAGTGAG GAACCCACAAGAGCATCAGGCTCAGCTAGAAGATCCACATCCTCTACAGGTCGGGGACCA AAGGCTGATTCTTGGAGATTTAACACCCCACAGGCAATGGGTTTATAGACATTATGTGAG TTTCCTGCTATATTAACATCATCTTAGACTTTGCAAGCAGAGAGTCGTGGAATCAAATCT GTGCTCTTTCATTTGCTAAGTGTATGATGTCACACAAGCTCCTTAACCTTCCATGTCTCC ATTTTCTTCTCTGTGAAGTAGGTATAAGAAGTCCTATCTCATAGGGATGCTGTGAGCATT AAATAAAGGTACACATGGAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001082618 |
| Insert Size | 1000 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001082618.1. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001082618.1, NP_001076087.1 |
| RefSeq Size | 1085 bp |
| RefSeq ORF | 714 bp |
| Locus ID | 945 |
| UniProt ID | P20138 |
| Protein Families | Druggable Genome, Transmembrane |
| Protein Pathways | Hematopoietic cell lineage |
| Gene Summary | Sialic-acid-binding immunoglobulin-like lectin (Siglec) that plays a role in mediating cell-cell interactions and in maintaining immune cells in a resting state (PubMed:10611343, PubMed:15597323, PubMed:11320212). Preferentially recognizes and binds alpha-2,3- and more avidly alpha-2,6-linked sialic acid-bearing glycans (PubMed:7718872). Upon engagement of ligands such as C1q or syalylated glycoproteins, two immunoreceptor tyrosine-based inhibitory motifs (ITIMs) located in CD33 cytoplasmic tail are phosphorylated by Src-like kinases such as LCK (PubMed:28325905, PubMed:10887109). These phosphorylations provide docking sites for the recruitment and activation of protein-tyrosine phosphatases PTPN6/SHP-1 and PTPN11/SHP-2 (PubMed:10556798, PubMed:10206955, PubMed:10887109). In turn, these phosphatases regulate downstream pathways through dephosphorylation of signaling molecules (PubMed:10206955, PubMed:10887109). One of the repressive effect of CD33 on monocyte activation requires phosphoinositide 3-kinase/PI3K (PubMed:15597323).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 5' coding region, compared to variant 1, resulting in a shorter protein (isoform 2, also known as CD33m), compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC217716 | CD33 (Myc-DDK-tagged)-Human CD33 molecule (CD33), transcript variant 2 |
CNY 3,600.00 |
|
| RC217716L1 | Lenti ORF clone of Human CD33 molecule (CD33), transcript variant 2, Myc-DDK-tagged |
CNY 6,000.00 |
|
| RC217716L2 | Lenti ORF clone of Human CD33 molecule (CD33), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RC217716L3 | Lenti ORF clone of Human CD33 molecule (CD33), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC217716L4 | Lenti ORF clone of Human CD33 molecule (CD33), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG217716 | CD33 (tGFP-tagged) - Human CD33 molecule (CD33), transcript variant 2 |
CNY 5,200.00 |
