DDT (NM_001084392) Human Untagged Clone
CAT#: SC316120
DDT (untagged)-Human D-dopachrome tautomerase (DDT), transcript variant 2
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | D-DT; DDCT; MIF-2; MIF2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC316120 representing NM_001084392.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCCGTTCCTGGAGCTGGACACGAATTTGCCCGCCAACCGAGTGCCCGCGGGGCTGGAGAAACGACTC TGCGCCGCCGCTGCCTCCATCCTGGGCAAACCTGCGGACCGCGTGAACGTGACGGTACGGCCGGGCCTG GCCATGGCGCTGAGCGGGTCCACCGAGCCCTGCGCGCAGCTGTCCATCTCCTCCATCGGCGTAGTGGGC ACCGCCGAGGACAACCGCAGCCACAGCGCCCACTTCTTTGAGTTTCTCACCAAGGAGCTAGCCCTGGGC CAGGACCGGATACTTATCCGCTTTTTCCCCTTGGAGTCCTGGCAGATTGGCAAGATAGGGACGGTCATG ACTTTTTTATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001084392 |
Insert Size | 357 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001084392.1 |
RefSeq Size | 637 bp |
RefSeq ORF | 357 bp |
Locus ID | 1652 |
UniProt ID | P30046 |
MW | 12.7 kDa |
Gene Summary | D-dopachrome tautomerase converts D-dopachrome into 5,6-dihydroxyindole. The DDT gene is related to the migration inhibitory factor (MIF) in terms of sequence, enzyme activity, and gene structure. DDT and MIF are closely linked on chromosome 22. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212637 | DDT (Myc-DDK-tagged)-Human D-dopachrome tautomerase (DDT), transcript variant 2 |
CNY 1,200.00 |
|
RC212637L3 | Lenti ORF clone of Human D-dopachrome tautomerase (DDT), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC212637L4 | Lenti ORF clone of Human D-dopachrome tautomerase (DDT), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG212637 | DDT (tGFP-tagged) - Human D-dopachrome tautomerase (DDT), transcript variant 2 |
CNY 4,370.00 |