GNG4 (NM_001098721) Human Untagged Clone
CAT#: SC316324
GNG4 (untagged)-Human guanine nucleotide binding protein (G protein), gamma 4 (GNG4), transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC316324 representing NM_001098721.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAAAGAGGGCATGTCTAATAACAGCACCACTAGCATCTCCCAAGCCAGGAAAGCTGTGGAGCAGCTA AAGATGGAAGCCTGTATGGACAGGGTCAAGGTCTCCCAGGCAGCTGCGGACCTCCTGGCCTACTGTGAA GCTCACGTGCGGGAAGATCCTCTCATCATTCCAGTGCCTGCATCAGAAAACCCCTTTCGCGAGAAGAAG TTCTTTTGTACCATTCTCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001098721 |
Insert Size | 228 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001098721.1 |
RefSeq Size | 4997 bp |
RefSeq ORF | 228 bp |
Locus ID | 2786 |
UniProt ID | P50150 |
Protein Families | Druggable Genome |
Protein Pathways | Chemokine signaling pathway |
MW | 8.4 kDa |
Gene Summary | Guanine nucleotide-binding proteins (G proteins) are involved as a modulator or transducer in various transmembrane signaling systems. The beta and gamma chains are required for the GTPase activity, for replacement of GDP by GTP, and for G protein-effector interaction.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212076 | GNG4 (Myc-DDK-tagged)-Human guanine nucleotide binding protein (G protein), gamma 4 (GNG4), transcript variant 2 |
CNY 1,200.00 |
|
RC212076L3 | Lenti ORF clone of Human guanine nucleotide binding protein (G protein), gamma 4 (GNG4), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC212076L4 | Lenti ORF clone of Human guanine nucleotide binding protein (G protein), gamma 4 (GNG4), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG212076 | GNG4 (tGFP-tagged) - Human guanine nucleotide binding protein (G protein), gamma 4 (GNG4), transcript variant 2 |
CNY 4,370.00 |