MID1IP1 (NM_001098790) Human Untagged Clone

CAT#: SC316339

MID1IP1 (untagged)-Human MID1 interacting protein 1 (gastrulation specific G12 homolog (zebrafish)) (MID1IP1), transcript variant 2



  "NM_001098790" in other vectors (6)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal antibody to MID1IP1 (MID1 interacting protein 1 (gastrulation specific G12 homolog (zebrafish)))
    • 100 ul

CNY 6,281.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms G12-like; MIG12; S14R; STRAIT11499; THRSPL
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC316339 representing NM_001098790.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGATGCAAATCTGCGACACCTACAACCAGAAGCACTCGCTCTTTAACGCCATGAATCGCTTCATTGGC
GCCGTGAACAACATGGACCAGACGGTGATGGTGCCCAGCTTGCTGCGCGACGTGCCCCTGGCTGACCCC
GGGTTAGACAACGATGTTGGCGTGGAGGTAGGCGGCAGTGGCGGCTGCCTGGAGGAGCGCACGCCCCCA
GTCCCCGACTCGGGAAGCGCCAATGGCAGCTTTTTCGCGCCCTCTCGGGACATGTACAGCCACTACGTG
CTTCTCAAGTCCATCCGCAACGACATCGAGTGGGGGGTCCTGCACCAGCCGCCTCCACCGGCTGGGAGC
GAGGAGGGCAGTGCCTGGAAGTCCAAGGACATCCTGGTGGACCTGGGCCACTTGGAGGGTGCGGACGCC
GGCGAAGAAGACCTGGAACAGCAGTTCCACTACCACCTGCGCGGGCTGCACACTGTGCTCTCGAAACTC
ACGCGCAAAGCCAACATCCTCACTAACAGATACAAGCAGGAGATCGGCTTCGGCAATTGGGGCCACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001098790
Insert Size 552 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001098790.1
RefSeq Size 2020 bp
RefSeq ORF 552 bp
Locus ID 58526
UniProt ID Q9NPA3
MW 20.2 kDa
Gene Summary Plays a role in the regulation of lipogenesis in liver. Up-regulates ACACA enzyme activity. Required for efficient lipid biosynthesis, including triacylglycerol, diacylglycerol and phospholipid. Involved in stabilization of microtubules (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses an alternate splice site in the 5' UTR, compared to variant 1. Variants 1, 2, and 3 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...