NANOS3 (NM_001098622) Human Untagged Clone
CAT#: SC316342
NANOS3 (untagged)-Human nanos homolog 3 (Drosophila) (NANOS3)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | NANOS1L; NOS3; ZC2HC12C |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC316342 representing NM_001098622.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGGACCTTTGACCTGTGGACAGATTACCTGGGTTTGGCACACCTGGTTAGGGCTCTGAGTGGGAAA GAGGGTCCTGAAACCAGGCTGAGCCCCCAGCCAGAGCCAGAGCCAATGCTGGAGCCGGTGTCAGCCCTG GAGCCGATGCCAGCGCCGGAGTCGGTGCCAGTGCCGGGACCCAAGGATCAGAAGCGCAGCCTGGAGTCC TCGCCAGCTCCCGAACGCCTGTGCTCTTTCTGCAAACACAACGGCGAGTCCCGGGCCATCTACCAGTCC CACGTGCTGAAGGACGAGGCTGGCAGGGTGCTGTGTCCCATCCTGCGGGACTACGTGTGTCCCCAGTGC GGCGCCACACGTGAGCGCGCCCACACCCGACGCTTCTGCCCACTTACTGGCCAGGGCTACACCTCCGTC TACAGCCACACCACCCGAAACTCGGCAGGCAAGAAGCTGGTCCGGCCTGACAAGGCGAAGACACAGGAC ACAGGCCACCGCCGAGGAGGAGGAGGAGGAGCAGGTTTCAGAGGTGCCGGGAAGTCTGAGCCTTCGCCC TCCTGCTCTCCCTCCATGTCCACCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001098622 |
Insert Size | 579 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001098622.2 |
RefSeq Size | 846 bp |
RefSeq ORF | 579 bp |
Locus ID | 342977 |
UniProt ID | P60323 |
MW | 20.7 kDa |
Gene Summary | Plays a role in the maintenance of the undifferentiated state of germ cells regulating the spermatogonia cell cycle and inducing a prolonged transit in G1 phase. Affects cell proliferation probably by repressing translation of specific mRNAs. Maintains the germ cell lineage by suppressing both Bax-dependent and -independent apoptotic pathways. Essential in the early stage embryo to protect the migrating primordial germ cells (PGCs) from apoptosis.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript and encodes the functional protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221867 | NANOS3 (Myc-DDK-tagged)-Human nanos homolog 3 (Drosophila) (NANOS3) |
CNY 2,400.00 |
|
RC221867L1 | Lenti ORF clone of Human nanos homolog 3 (Drosophila) (NANOS3), Myc-DDK-tagged |
CNY 4,800.00 |
|
RC221867L2 | Lenti ORF clone of Human nanos homolog 3 (Drosophila) (NANOS3), mGFP tagged |
CNY 5,890.00 |
|
RC221867L3 | Lenti ORF clone of Human nanos homolog 3 (Drosophila) (NANOS3), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC221867L4 | Lenti ORF clone of Human nanos homolog 3 (Drosophila) (NANOS3), mGFP tagged |
CNY 5,890.00 |
|
RG221867 | NANOS3 (tGFP-tagged) - Human nanos homolog 3 (Drosophila) (NANOS3) |
CNY 4,000.00 |