NANOS3 (NM_001098622) Human Untagged Clone

CAT#: SC316342

NANOS3 (untagged)-Human nanos homolog 3 (Drosophila) (NANOS3)



  "NM_001098622" in other vectors (6)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Nanos3 Antibody
    • 100 ug

CNY 5,808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms NANOS1L; NOS3; ZC2HC12C
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC316342 representing NM_001098622.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGGACCTTTGACCTGTGGACAGATTACCTGGGTTTGGCACACCTGGTTAGGGCTCTGAGTGGGAAA
GAGGGTCCTGAAACCAGGCTGAGCCCCCAGCCAGAGCCAGAGCCAATGCTGGAGCCGGTGTCAGCCCTG
GAGCCGATGCCAGCGCCGGAGTCGGTGCCAGTGCCGGGACCCAAGGATCAGAAGCGCAGCCTGGAGTCC
TCGCCAGCTCCCGAACGCCTGTGCTCTTTCTGCAAACACAACGGCGAGTCCCGGGCCATCTACCAGTCC
CACGTGCTGAAGGACGAGGCTGGCAGGGTGCTGTGTCCCATCCTGCGGGACTACGTGTGTCCCCAGTGC
GGCGCCACACGTGAGCGCGCCCACACCCGACGCTTCTGCCCACTTACTGGCCAGGGCTACACCTCCGTC
TACAGCCACACCACCCGAAACTCGGCAGGCAAGAAGCTGGTCCGGCCTGACAAGGCGAAGACACAGGAC
ACAGGCCACCGCCGAGGAGGAGGAGGAGGAGCAGGTTTCAGAGGTGCCGGGAAGTCTGAGCCTTCGCCC
TCCTGCTCTCCCTCCATGTCCACCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001098622
Insert Size 579 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001098622.2
RefSeq Size 846 bp
RefSeq ORF 579 bp
Locus ID 342977
UniProt ID P60323
MW 20.7 kDa
Gene Summary Plays a role in the maintenance of the undifferentiated state of germ cells regulating the spermatogonia cell cycle and inducing a prolonged transit in G1 phase. Affects cell proliferation probably by repressing translation of specific mRNAs. Maintains the germ cell lineage by suppressing both Bax-dependent and -independent apoptotic pathways. Essential in the early stage embryo to protect the migrating primordial germ cells (PGCs) from apoptosis.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript and encodes the functional protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...