SynCAM (CADM1) (NM_001098517) Human Untagged Clone
CAT#: SC316373
CADM1 (untagged)-Human cell adhesion molecule 1 (CADM1), transcript variant 2
CNY 6,650.00
Cited in 1 publication. |
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BL2; IGSF4; IGSF4A; Necl-2; NECL2; RA175; sgIGSF; ST17; sTSLC-1; SYNCAM; synCAM1; TSLC1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC316373 representing NM_001098517.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCGAGTGTAGTGCTGCCGAGCGGATCCCAGTGTGCGGCGGCAGCGGCGGCGGCGGCGCCTCCCGGG CTCCGGCTCCGGCTTCTGCTGTTGCTCTTCTCCGCCGCGGCACTGATCCCCACAGGTGATGGGCAGAAT CTGTTTACGAAAGACGTGACAGTGATCGAGGGAGAGGTTGCGACCATCAGTTGCCAAGTCAATAAGAGT GACGACTCTGTGATTCAGCTACTGAATCCCAACAGGCAGACCATTTATTTCAGGGACTTCAGGCCTTTG AAGGACAGCAGGTTTCAGTTGCTGAATTTTTCTAGCAGTGAACTCAAAGTATCATTGACAAACGTCTCA ATTTCTGATGAAGGAAGATACTTTTGCCAGCTCTATACCGATCCCCCACAGGAAAGTTACACCACCATC ACAGTCCTGGTCCCACCACGTAATCTGATGATCGATATCCAGAAAGACACTGCGGTGGAAGGTGAGGAG ATTGAAGTCAACTGCACTGCTATGGCCAGCAAGCCAGCCACGACTATCAGGTGGTTCAAAGGGAACACA GAGCTAAAAGGCAAATCGGAGGTGGAAGAGTGGTCAGACATGTACACTGTGACCAGTCAGCTGATGCTG AAGGTGCACAAGGAGGACGATGGGGTCCCAGTGATCTGCCAGGTGGAGCACCCTGCGGTCACTGGAAAC CTGCAGACCCAGCGGTATCTAGAAGTACAGTATAAGCCTCAAGTGCACATTCAGATGACTTATCCTCTA CAAGGCTTAACCCGGGAAGGGGACGCGCTTGAGTTAACATGTGAAGCCATCGGGAAGCCCCAGCCTGTG ATGGTAACTTGGGTGAGAGTCGATGATGAAATGCCTCAACACGCCGTACTGTCTGGGCCCAACCTGTTC ATCAATAACCTAAACAAAACAGATAATGGTACATACCGCTGTGAAGCTTCAAACATAGTGGGGAAAGCT CACTCGGATTATATGCTGTATGTATACGATTCCCGAGCAGGTGAAGAAGGCTCGATCAGGGCAGTGGAT CATGCCGTGATCGGTGGCGTCGTGGCGGTGGTGGTGTTCGCCATGCTGTGCTTGCTCATCATTCTGGGG CGCTATTTTGCCAGACATAAAGGTACATACTTCACTCATGAAGCCAAAGGAGCCGATGACGCAGCAGAC GCAGACACAGCTATAATCAATGCAGAAGGAGGACAGAACAACTCCGAAGAAAAGAAAGAGTACTTCATC TAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001098517 |
Insert Size | 1245 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001098517.1 |
RefSeq Size | 4240 bp |
RefSeq ORF | 1245 bp |
Locus ID | 23705 |
UniProt ID | Q9BY67 |
Protein Families | Transmembrane |
Protein Pathways | Cell adhesion molecules (CAMs) |
MW | 45.6 kDa |
Gene Summary | Mediates homophilic cell-cell adhesion in a Ca(2+)-independent manner. Also mediates heterophilic cell-cell adhesion with CADM3 and NECTIN3 in a Ca(2+)-independent manner. Acts as a tumor suppressor in non-small-cell lung cancer (NSCLC) cells. Interaction with CRTAM promotes natural killer (NK) cell cytotoxicity and interferon-gamma (IFN-gamma) secretion by CD8+ cells in vitro as well as NK cell-mediated rejection of tumors expressing CADM3 in vivo. May contribute to the less invasive phenotypes of lepidic growth tumor cells. In mast cells, may mediate attachment to and promote communication with nerves. CADM1, together with MITF, is essential for development and survival of mast cells in vivo. Acts as a synaptic cell adhesion molecule and plays a role in the formation of dendritic spines and in synapse assembly (By similarity). May be involved in neuronal migration, axon growth, pathfinding, and fasciculation on the axons of differentiating neurons. May play diverse roles in the spermatogenesis including in the adhesion of spermatocytes and spermatids to Sertoli cells and for their normal differentiation into mature spermatozoa.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks three alternate in-frame exons compared to variant 3. The resulting isoform (2, also known as E) has the same N- and C-termini but is shorter compared to isoform A. |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
From the Cover: Synaptic cell adhesion molecule SynCAM 1 is a target for polysialylation in postnatal mouse brain
,Sebastian P. Galuska, Manuela Rollenhagen, Moritz Kaup, Katinka Eggers, Imke Oltmann-Norden, Miriam Schiff, Maike Hartmann, Birgit Weinhold, Herbert Hildebrandt, Rudolf Geyer, Martina Mühlenhoff, and Hildegard Geyer,
PNAS, Jun 2010; 107: 10250 - 10255
[CADM1]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC224904 | CADM1 (Myc-DDK-tagged)-Human cell adhesion molecule 1 (CADM1), transcript variant 2 |
CNY 3,656.00 |
|
RC224904L3 | Lenti-ORF clone of CADM1 (Myc-DDK-tagged)-Human cell adhesion molecule 1 (CADM1), transcript variant 2 |
CNY 5,890.00 |
|
RC224904L4 | Lenti-ORF clone of CADM1 (mGFP-tagged)-Human cell adhesion molecule 1 (CADM1), transcript variant 2 |
CNY 5,890.00 |
|
RG224904 | CADM1 (tGFP-tagged) - Human cell adhesion molecule 1 (CADM1), transcript variant 2 |
CNY 4,370.00 |