KDELR2 (NM_001100603) Human Untagged Clone

CAT#: SC316671

KDELR2 (untagged)-Human KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2 (KDELR2), transcript variant 2



  "NM_001100603" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-KDELR2 Antibody
    • 50 ug

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ELP-1; ELP1; ERD2.2; OI21
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC316671 representing NM_001100603.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAACATTTTCCGGCTGACTGGGGACCTGTCCCACCTGGCGGCCATCGTCATCCTGCTGCTGAAGATC
TGGAAGACGCGCTCCTGCGCCGGTATTTCTGGGAAAAGCCAGCTTCTGTTTGCACTGGTCTTCACAACT
CGTTACCTGGATCTTTTTACTTCATTTATTTCATTGTATAACACATCTATGAAGGTTATCTACCTTGCC
TGCTCCTATGCCACAGTGTACCTGATCTACCTGAAATTTAAGGCAACCTACGATGGAAATCATGATACC
TTCCGAGTGGAGTTTCTGGTGGTCCCTGTGGGAGGCCTCTCATTTTTAGTTAATCACGATTTCTCTCCT
CTTGAGTACTCAAGGGAAAGAAGCTCAGTTTGCCAGCATAAGTGCCAAAGACCATCACCAGCATCTGTC
CTTCAGGGTGCTCGGACAGAATTCTTACCACAGCAAAGGCATAAGATGCTTGATACGGAAAATCAGAAA
CTTAACTCTTTTGTTGCAGATAGTCATCAGTGGCTCTGTAAAAACGCAGAGGAAAAGAGCCAGAAGGTT
TCTGTTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001100603
Insert Size 561 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001100603.1
RefSeq Size 2621 bp
RefSeq ORF 561 bp
Locus ID 11014
UniProt ID P33947
Protein Families Druggable Genome, Transmembrane
Protein Pathways Vibrio cholerae infection
MW 21.2 kDa
Gene Summary Retention of resident soluble proteins in the lumen of the endoplasmic reticulum (ER) is achieved in both yeast and animal cells by their continual retrieval from the cis-Golgi, or a pre-Golgi compartment. Sorting of these proteins is dependent on a C-terminal tetrapeptide signal, usually lys-asp-glu-leu (KDEL) in animal cells, and his-asp-glu-leu (HDEL) in S. cerevisiae. This process is mediated by a receptor that recognizes, and binds the tetrapeptide-containing protein, and returns it to the ER. In yeast, the sorting receptor encoded by a single gene, ERD2, is a seven-transmembrane protein. Unlike yeast, several human homologs of the ERD2 gene, constituting the KDEL receptor gene family, have been described. KDELR2 was the second member of the family to be identified, and it encodes a protein which is 83% identical to the KDELR1 gene product. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) lacks an exon in the coding region, compared to variant 1, which results in a frameshift, compared to variant 1. The encoded isoform (2) has a longer and distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...