ICAM2 (NM_001099788) Human Untagged Clone
CAT#: SC316703
ICAM2 (untagged)-Human intercellular adhesion molecule 2 (ICAM2), transcript variant 3
CNY 6,270.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CD102 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001099788, the custom clone sequence may differ by one or more nucleotides
ATGTCCTCTTTCGGTTACAGGACCCTGACTGTGGCCCTCTTCACCCTGATCTGCTGTCCA GGATCGGATGAGAAGGTATTCGAGGTACACGTGAGGCCAAAGAAGCTGGCGGTTGAGCCC AAAGGGTCCCTCGAGGTCAACTGCAGCACCACCTGTAACCAGCCTGAAGTGGGTGGTCTG GAGACCTCTCTAGATAAGATTCTGCTGGACGAACAGGCTCAGTGGAAACATTACTTGGTC TCAAACATCTCCCATGACACGGTCCTCCAATGCCACTTCACCTGCTCCGGGAAGCAGGAG TCAATGAATTCCAACGTCAGCGTGTACCAGCCTCCAAGGCAGGTCATCCTGACACTGCAA CCCACTTTGGTGGCTGTGGGCAAGTCCTTCACCATTGAGTGCAGGGTGCCCACCGTGGAG CCCCTGGACAGCCTCACCCTCTTCCTGTTCCGTGGCAATGAGACTCTGCACTATGAGACC TTCGGGAAGGCAGCCCCTGCTCCGCAGGAGGCCACAGCCACATTCAACAGCACGGCTGAC AGAGAGGATGGCCACCGCAACTTCTCCTGCCTGGCTGTGCTGGACTTGATGTCTCGCGGT GGCAACATCTTTCACAAACACTCAGCCCCGAAGATGTTGGAGATCTATGAGCCTGTGTCG GACAGCCAGATGGTCATCATAGTCACGGTGGTGTCGGTGTTGCTGTCCCTGTTCGTGACA TCTGTCCTGCTCTGCTTCATCTTCGGCCAGCACTTGCGCCAGCAGCGGATGGGCACCTAC GGGGTGCGAGCGGCTTGGAGGAGGCTGCCCCAGGCCTTCCGGCCA |
Restriction Sites | Please inquire |
ACCN | NM_001099788 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001099788.1, NP_001093258.1 |
RefSeq Size | 1235 bp |
RefSeq ORF | 828 bp |
Locus ID | 3384 |
UniProt ID | P13598 |
Protein Families | ES Cell Differentiation/IPS, Transmembrane |
Protein Pathways | Cell adhesion molecules (CAMs), Natural killer cell mediated cytotoxicity |
Gene Summary | The protein encoded by this gene is a member of the intercellular adhesion molecule (ICAM) family. All ICAM proteins are type I transmembrane glycoproteins, contain 2-9 immunoglobulin-like C2-type domains, and bind to the leukocyte adhesion LFA-1 protein. This protein may play a role in lymphocyte recirculation by blocking LFA-1-dependent cell adhesion. It mediates adhesive interactions important for antigen-specific immune response, NK-cell mediated clearance, lymphocyte recirculation, and other cellular interactions important for immune response and surveillance. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. All 5 variants encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216706 | ICAM2 (Myc-DDK-tagged)-Human intercellular adhesion molecule 2 (ICAM2), transcript variant 3 |
CNY 2,400.00 |
|
RC216706L3 | Lenti-ORF clone of ICAM2 (Myc-DDK-tagged)-Human intercellular adhesion molecule 2 (ICAM2), transcript variant 3 |
CNY 5,890.00 |
|
RC216706L4 | Lenti-ORF clone of ICAM2 (mGFP-tagged)-Human intercellular adhesion molecule 2 (ICAM2), transcript variant 3 |
CNY 5,890.00 |
|
RG216706 | ICAM2 (tGFP-tagged) - Human intercellular adhesion molecule 2 (ICAM2), transcript variant 3 |
CNY 4,370.00 |