United States
Germany
Japan
United Kingdom
China
CCR5 (NM_001100168) Human Untagged Clone
CAT＃: SC316730
CCR5 (untagged)-Human chemokine (C-C motif) receptor 5 (CCR5), transcript variant B
CNY 3,656.00
CNY 7,220.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CC-CKR-5; CCCKR5; CCR-5; CD195; CKR-5; CKR5; CMKBR5; IDDM22 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF within SC316730 sequence for NM_001100168 edited (data generated by NextGen Sequencing)
ATGGATTATCAAGTGTCAAGTCCAATCTATGACATCAATTATTATACATCGGAGCCCTGCCAAAAAATCA ATGTGAAGCAAATCGCAGCCCGCCTCCTGCCTCCGCTCTACTCACTGGTGTTCATCTTTGGTTTTGTGGG CAACATGCTGGTCATCCTCATCCTGATAAACTGCAAAAGGCTGAAGAGCATGACTGACATCTACCTGCTC AACCTGGCCATCTCTGACCTGTTTTTCCTTCTTACTGTCCCCTTCTGGGCTCACTATGCTGCCGCCCAGT GGGACTTTGGAAATACAATGTGTCAACTCTTGACAGGGCTCTATTTTATAGGCTTCTTCTCTGGAATCTT CTTCATCATCCTCCTGACAATCGATAGGTACCTGGCTGTCGTCCATGCTGTGTTTGCTTTAAAAGCCAGG ACGGTCACCTTTGGGGTGGTGACAAGTGTGATCACTTGGGTGGTGGCTGTGTTTGCGTCTCTCCCAGGAA TCATCTTTACCAGATCTCAAAAAGAAGGTCTTCATTACACCTGCAGCTCTCATTTTCCATACAGTCAGTA TCAATTCTGGAAGAATTTCCAGACATTAAAGATAGTCATCTTGGGGCTGGTCCTGCCGCTGCTTGTCATG GTCATCTGCTACTCGGGAATCCTAAAAACTCTGCTTCGGTGTCGAAATGAGAAGAAGAGGCACAGGGCTG TGAGGCTTATCTTCACCATCATGATTGTTTATTTTCTCTTCTGGGCTCCCTACAACATTGTCCTTCTCCT GAACACCTTCCAGGAATTCTTTGGCCTGAATAATTGCAGTAGCTCTAACAGGTTGGACCAAGCTATGCAG GTGACAGAGACTCTTGGGATGACGCACTGCTGCATCAACCCCATCATCTATGCCTTTGTCGGGGAGAAGT TCAGAAACTACCTCTTAGTCTTCTTCCAAAAGCACATTGCCAAACGCTTCTGCAAATGCTGTTCTATTTT CCAGCAAGAGGCTCCCGAGCGAGCAAGCTCAGTTTACACCCGATCCACTGGGGAGCAGGAAATATCTGTG GGCTTGTGA Clone variation with respect to NM_001100168.1 |
| Restriction Sites | Please inquire |
| ACCN | NM_001100168 |
| Insert Size | 1200 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The open reading frame of this clone has been fully sequenced and found to be a perfect match to the protein associated with this reference, NM_001100168.1. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001100168.1, NP_001093638.1 |
| RefSeq Size | 3451 bp |
| RefSeq ORF | 1059 bp |
| Locus ID | 1234 |
| UniProt ID | P51681 |
| Protein Families | Druggable Genome, ES Cell Differentiation/IPS, GPCR, Transmembrane |
| Protein Pathways | Chemokine signaling pathway, Cytokine-cytokine receptor interaction, Endocytosis |
| Gene Summary | This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. This protein is expressed by T cells and macrophages, and is known to be an important co-receptor for macrophage-tropic virus, including HIV, to enter host cells. Defective alleles of this gene have been associated with the HIV infection resistance. The ligands of this receptor include monocyte chemoattractant protein 2 (MCP-2), macrophage inflammatory protein 1 alpha (MIP-1 alpha), macrophage inflammatory protein 1 beta (MIP-1 beta) and regulated on activation normal T expressed and secreted protein (RANTES). Expression of this gene was also detected in a promyeloblastic cell line, suggesting that this protein may play a role in granulocyte lineage proliferation and differentiation. This gene is located at the chemokine receptor gene cluster region. An allelic polymorphism in this gene results in both functional and non-functional alleles; the reference genome represents the functional allele. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2015] Transcript Variant: This variant (B) differs in the 5' UTR compared to variant A. Both variants encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by published experimental evidence. |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
The Second Extracellular Loop of CCR5 Contains the Dominant Epitopes for Highly Potent Anti-HIV Monoclonal Antibodies
,Jun Zhang, Eileen Rao, Marianna Dioszegi, Rama Kondru, Andre Derosier, Eva Chan, Stephan Schwoerer, Nick Cammack, Michael Brandt, Surya Sankuratri, and Changhua Ji,
Antimicrob Agents Chemother. 2007 Apr;51(4):1386-97.
[CCR5]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC216008 | CCR5 (Myc-DDK-tagged)-Human chemokine (C-C motif) receptor 5 (CCR5), transcript variant B |
CNY 3,656.00 |
|
| RC216008L3 | Lenti-ORF clone of CCR5 (Myc-DDK-tagged)-Human chemokine (C-C motif) receptor 5 (CCR5), transcript variant B |
CNY 5,890.00 |
|
| RC216008L4 | Lenti-ORF clone of CCR5 (mGFP-tagged)-Human chemokine (C-C motif) receptor 5 (CCR5), transcript variant B |
CNY 5,890.00 |
|
| RG216008 | CCR5 (tGFP-tagged) - Human chemokine (C-C motif) receptor 5 (CCR5), transcript variant B |
CNY 4,370.00 |
