PSMA4 (NM_001102668) Human Untagged Clone
CAT#: SC316905
PSMA4 (untagged)-Human proteasome (prosome, macropain) subunit, alpha type, 4 (PSMA4), transcript variant 3
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HC9; HsT17706; PSC9 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC316905 representing NM_001102668.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCTTGCAGTGTGGCAGGCATAACTTCTGATGCTAATGTTCTGACTAATGAACTAAGGCTCATTGCT CAAAGGTATTTATTACAGTATCAGGAGCCAATACCTTGTGAGCAGTTGGTTACAGCGCTGTGTGATATC AAACAAGCTTATACACAATTTGGAGGAAAACGTCCCTTTGGTGTTTCATTGCTGTACATTGGCTGGGAT AAGCACTATGGCTTTCAGCTCTATCAGAGTGACCCTAGTGGAAATTACGGGGGATGGAAGGCCACATGC ATTGGAAATAATAGCGCTGCAGCTGTGTCAATGTTGAAACAAGACTATAAAGAAGGAGAAATGACCTTG AAGTCAGCACTTGCTTTAGCTATCAAAGTACTAAATAAGACCATGGATGTTAGTAAACTCTCTGCTGAA AAAGTGGAAATTGCAACACTAACAAGAGAGAATGGAAAGACAGTAATCAGAGTTCTCAAACAAAAAGAA GTGGAGCAGTTGATCAAAAAACATGAGGAAGAAGAAGCCAAAGCTGAGCGTGAGAAGAAAGAAAAAGAA CAGAAAGAAAAGGATAAATAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001102668 |
Insert Size | 573 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001102668.1 |
RefSeq Size | 1072 bp |
RefSeq ORF | 573 bp |
Locus ID | 5685 |
UniProt ID | P25789 |
Protein Families | Druggable Genome, Protease |
Protein Pathways | Proteasome |
MW | 21.4 kDa |
Gene Summary | This gene encodes a core alpha subunit of the 20S proteosome, which is a highly ordered ring-shaped structure composed of four rings of 28 non-identical subunits. Proteasomes cleave peptides in an ATP- and ubiquitin-dependent manner. [provided by RefSeq, Aug 2016] Transcript Variant: This variant (3) lacks an exon in the 5' coding region and uses a downstream start codon, compared to variant 1. It encodes isoform 2, which has a shorter N-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220432 | PSMA4 (Myc-DDK-tagged)-Human proteasome (prosome, macropain) subunit, alpha type, 4 (PSMA4), transcript variant 3 |
CNY 2,400.00 |
|
RC220432L3 | Lenti ORF clone of Human proteasome (prosome, macropain) subunit, alpha type, 4 (PSMA4), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC220432L4 | Lenti ORF clone of Human proteasome (prosome, macropain) subunit, alpha type, 4 (PSMA4), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
RG220432 | PSMA4 (tGFP-tagged) - Human proteasome (prosome, macropain) subunit, alpha type, 4 (PSMA4), transcript variant 3 |
CNY 4,370.00 |