United States
Germany
Japan
United Kingdom
China
GNAT3 (NM_001102386) Human Untagged Clone
CAT＃: SC316926
GNAT3 (untagged)-Human guanine nucleotide binding protein, alpha transducing 3 (GNAT3)
CNY 5,488.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | GDCA |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_001102386 edited
AGCCACCATGGGAAGTGGAATTAGTTCAGAGAGCAAGGAGTCAGCCAAAAGATCAAAAGA ACTGGAGAAAAAGCTTCAGGAGGATGCTGAGCGAGATGCAAGAACCGTAAAGCTGCTACT ATTAGGAGCAGGAGAATCTGGGAAAAGTACTATTGTTAAACAAATGAAGATCATCCATAA GAATGGTTACAGTGAGCAAGAATGCATGGAGTTCAAAGCAGTAATTTACAGTAATACATT GCAATCCATCCTAGCTATTGTGAAAGCCATGACTACCCTTGGAATTGATTATGTAAATCC CAGAAGTGCAGAGGACCAACGACAACTTTATGCAATGGCAAATACCCTGGAAGATGGTGG CATGACACCTCAACTGGCTGAGGTAATAAAACGGCTGTGGAGAGATCCAGGAATTCAGGC CTGCTTTGAAAGGGCATCTGAATATCAGCTCAATGACTCAGCAGCTTACTACCTTAATGA TTTAGATAGAATAACAGCATCTGGGTATGTGCCAAATGAACAAGATGTTCTCCATTCTCG AGTGAAAACGACTGGAATCATTGAAACTCAATTCTCCTTTAAAGACTTGCACTTCAGGAT GTTTGATGTAGGTGGACAGAGATCTGAGAGAAAGAAGTGGATTCACTGCTTTGAAGGAGT TACATGCATTATATTTTGTGCTGCACTTAGTGCCTATGACATGGTCCTCGTGGAAGACGA AGAAGTGAATAGAATGCATGAAAGCCTTCACCTGTTCAACAGTATCTGTAATCACAAGTA TTTTTCAACAACCTCCATTGTCCTGTTCCTCAACAAAAAAGATATCTTTCAAGAAAAGGT AACCAAGGTGCATCTTAGTATCTGCTTTCCAGAATACACTGGGCCAAATACATTTGAAGA TGCAGGAAACTACATCAAGAACCAGTTTCTAGACCTGAATTTAAAAAAAGAAGATAAGGA AATTTATTCCCACATGACCTGTGCTACTGACACCCAAAATGTCAAGTTTGTGTTTGACGC AGTTACAGATATAATAATCAAAGAGAATCTAAAAGACTGTGGGCTTTTCTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001102386 |
| Insert Size | 1100 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | The final clone was fully sequenced and it matches with NM_001102386.1. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001102386.1, NP_001095856.1 |
| RefSeq Size | 1065 bp |
| RefSeq ORF | 1065 bp |
| Locus ID | 346562 |
| UniProt ID | A8MTJ3 |
| Protein Pathways | Taste transduction |
| Gene Summary | Sweet, bitter, and umami tastes are transmitted from taste receptors by a specific guanine nucleotide binding protein. The protein encoded by this gene is the alpha subunit of this heterotrimeric G protein, which is found not only in the oral epithelium but also in gut tissues. Variations in this gene have been linked to metabolic syndrome. [provided by RefSeq, Dec 2015] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC224201 | GNAT3 (Myc-DDK-tagged)-Human guanine nucleotide binding protein, alpha transducing 3 (GNAT3) |
CNY 5,488.00 |
|
| RC224201L1 | Lenti ORF clone of Human guanine nucleotide binding protein, alpha transducing 3 (GNAT3), Myc-DDK-tagged |
CNY 7,888.00 |
|
| RC224201L2 | Lenti ORF clone of Human guanine nucleotide binding protein, alpha transducing 3 (GNAT3), mGFP tagged |
CNY 5,890.00 |
|
| RC224201L3 | Lenti ORF clone of Human guanine nucleotide binding protein, alpha transducing 3 (GNAT3), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC224201L4 | Lenti ORF clone of Human guanine nucleotide binding protein, alpha transducing 3 (GNAT3), mGFP tagged |
CNY 5,890.00 |
|
| RG224201 | GNAT3 (tGFP-tagged) - Human guanine nucleotide binding protein, alpha transducing 3 (GNAT3) |
CNY 7,088.00 |
