DPM3 (NM_018973) Human Untagged Clone
CAT#: SC317229
DPM3 (untagged)-Human dolichyl-phosphate mannosyltransferase polypeptide 3 (DPM3), transcript variant 1
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CDG1O; MDDGB15; MDDGC15 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC317229 representing NM_018973.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCTCTCCGTGGGCGGGCTTCGGTTGAGTTTGGTCCGCTTTTCCTTTCTGCTCCTCAGGGGAGCATTG CTTCCTTCTCTCGCAGTGACCATGACGAAATTAGCGCAGTGGCTTTGGGGACTAGCGATCCTGGGCTCC ACCTGGGTGGCCCTGACCACGGGAGCCTTGGGCCTGGAGCTGCCCTTGTCCTGCCAGGAAGTCCTGTGG CCACTGCCCGCCTACTTGCTGGTGTCCGCCGGCTGCTATGCCCTGGGCACTGTGGGCTATCGTGTGGCC ACTTTTCATGACTGCGAGGACGCCGCACGCGAGCTGCAGAGCCAGATACAGGAGGCCCGAGCCGACTTA GCCCGCAGGGGGCTGCGCTTCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_018973 |
Insert Size | 369 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_018973.3 |
RefSeq Size | 532 bp |
RefSeq ORF | 369 bp |
Locus ID | 54344 |
UniProt ID | Q9P2X0 |
Protein Families | Transmembrane |
Protein Pathways | Metabolic pathways, N-Glycan biosynthesis |
MW | 13.3 kDa |
Gene Summary | Dolichol-phosphate mannose (Dol-P-Man) serves as a donor of mannosyl residues on the lumenal side of the endoplasmic reticulum (ER). Lack of Dol-P-Man results in defective surface expression of GPI-anchored proteins. Dol-P-Man is synthesized from GDP-mannose and dolichol-phosphate on the cytosolic side of the ER by the enzyme dolichyl-phosphate mannosyltransferase. The protein encoded by this gene is a subunit of dolichyl-phosphate mannosyltransferase and acts as a stabilizer subunit of the dolichyl-phosphate mannosyltransferase complex. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212952 | DPM3 (Myc-DDK-tagged)-Human dolichyl-phosphate mannosyltransferase polypeptide 3 (DPM3), transcript variant 1 |
CNY 1,200.00 |
|
RC212952L1 | Lenti ORF clone of Human dolichyl-phosphate mannosyltransferase polypeptide 3 (DPM3), transcript variant 1, Myc-DDK-tagged |
CNY 3,600.00 |
|
RC212952L2 | Lenti ORF clone of Human dolichyl-phosphate mannosyltransferase polypeptide 3 (DPM3), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC212952L3 | Lenti ORF clone of Human dolichyl-phosphate mannosyltransferase polypeptide 3 (DPM3), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC212952L4 | Lenti ORF clone of Human dolichyl-phosphate mannosyltransferase polypeptide 3 (DPM3), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG212952 | DPM3 (tGFP-tagged) - Human dolichyl-phosphate mannosyltransferase polypeptide 3 (DPM3), transcript variant 1 |
CNY 2,800.00 |
|
SC111815 | DPM3 (untagged)-Human dolichyl-phosphate mannosyltransferase polypeptide 3 (DPM3), transcript variant 1 |
CNY 1,200.00 |