GAGE1 (NM_001468) Human Untagged Clone

CAT#: SC317240

GAGE1 (untagged)-Human G antigen 1 (GAGE1), transcript variant 1



  "NM_001468" in other vectors (5)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CT4.1; GAGE-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC317240 representing NM_001468.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGTTGGCGAGGAAGATCGACCTATTATTGGCCTAGACCAAGGCGCTATGTACAGCCTCCTGAAATG
ATTGGGCCTATGCGGCCCGAGCAGTTCAGTGATGAAGTGGAACCAGCAACACCTGAAGAAGGGGAACCA
GCAACTCAACGTCAGGATCCTGCAGCTGCTCAGGAGGGAGAGGATGAGGGAGCATCTGCAGGTCAAGGG
CCGAAGCCTGAAGCTGATAGCCAGGAACAGGGTCACCCACAGACTGGGTGTGAGTGTGAAGATGGTCCT
GATGGGCAGGAGATGGACCCGCCAAATCCAGAGGAGGTGAAAACGCCTGAAGAAGAGATGAGGTCTCAC
TATGTTGCCCAGACTGGGATTCTCTGGCTTTTAATGAACAATTGCTTCTTAAATCTTTCCCCACGGAAA
CCTTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001468
Insert Size 420 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001468.4
RefSeq Size 3157 bp
RefSeq ORF 420 bp
Locus ID 2543
MW 15.6 kDa
Gene Summary This gene belongs to a family of genes that are expressed in a variety of tumors but not in normal tissues, except for the testis. The sequences of the family members are highly related but differ by scattered nucleotide substitutions. The antigenic peptide YRPRPRRY, which is also encoded by several other family members, is recognized by autologous cytolytic T lymphocytes. Nothing is presently known about the function of this protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2010]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...